dennis crowley and naveen selvadurai development company foursquare tags visual design connectivity client a

iPhone Design Award-Winning Projects phần 4 ppsx

Ngày tải lên : 13/08/2014, 18:20

... tabbed interface packs data into a friendly format 53 54 CHAPTER 4: Q &A: Foursquare Dennis Crowley and Naveen Selvadurai are Foursquare s founders, and built Foursquare for iPhone as a team Determined ... 52 CHAPTER 3: Topple 53 Chapter Q &A: Foursquare Developer Name: Dennis Crowley and Naveen Selvadurai Development Company: Foursquare Tags: Visual Design; Connectivity; Client App; Workflow ... Cram More Data into a Local App–Large Images, Geo Data, and Lots of It Who says that a small computer has to run small apps? Certainly no one at Intermap, makers of AccuTerra This GPS-mapping app...

21
202
0

Báo cáo toán học: " Transient noise reduction in speech signal with a modified long-term predictor" ppt

Ngày tải lên : 20/06/2014, 21:20

... Residual signal after applying speech modeling filter to noisy speech Time-domain waveforms of (a) : Noise signal, (b): Residual signal after STP analysis, and (c): Residual signal after LTP analysis ... analysis Table NCC between transient noise and residual signals Residual after STP analysis NCC Residual after LTP analysis 0.8267 0.9908 The NCCs between transient noise and residual signals after ... manuscript H-GK guided the study, designed the evaluation, and corrected the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have...

9
464
0

Báo cáo y học: "Impaired nuclear import and viral incorporation of Vpr derived from a HIV long-term non-progressor" docx

Ngày tải lên : 13/08/2014, 05:21

... Proc Natl Acad Sci USA 1994, 91:7311-7315 Iijima S, Nitahara-Kasahara Y, Kimata K, Zhong Zhuang W, Kamata M, Isogai M, Miwa M, Tsunetsugu-Yokota Y, Aida Y: Nuclear localization of Vpr is crucial ... Wee1 and Cdc25 Virology 2001, 287:359-370 Matsuda N, Tanaka H, Yamazaki S, Suzuki J-I, Tanaka K, Yamada T, Masuda M: HIV-1 Vpr induces G2 cell cycle arrest in fission yeast associated with Rad24/14-3-3-dependent, ... defense against viral attack Nat Immunol 2004, 5:1109-1115 Wang B, Dyer WB, Zaunders JJ, Mikhail M, Sullivan JS, Williams L, Haddad DN, Harris G, Holt JA, Cooper DA, Miranda-Saksena M, Boadle R,...

7
268
0

Tài liệu Is the long-term interest rate a policy victim, a policy variable or a policy lodestar? docx

Ngày tải lên : 17/02/2014, 03:20

... Europe and Japan Total As shown in Graph banks At average annual rate Fannie Mae, Freddie Mac and the Federal Home Loan Source: Dealogic, BIS calculations Table Composition of marketable US Federal ... implementation due by end-2011) (c) An elastic supply of “new” AAA-rated paper These strong and growing demands for AAA-rated paper swamped the volume of bonds issued by AAA governments and official ... sub-prime mortgages and other doubtful debts led to a dramatic shrinkage in ABS issuance Yet the crisis itself also paradoxically favoured alternative AAA-rated paper Because banks found it harder to...

39
514
0

Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

Ngày tải lên : 23/03/2014, 06:20

... ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa ... ischemia and focal cerebral ischemia Proc Natl Acad Sci USA 98, 11569–11574 ´ ´ 10 Amran D, Sancho P, Fernandez C, Esteban D, Ramos ´ AM, de Blas E, Gomez M, Palacios MA & Aller P (2005) Pharmacological ... with ClaI–Sse8387I pEGFPN1 and pDSRed-N1 are from Clontech (Mountain View, CA, USA) siRNA sequences are: ZIP8 #1, accuaaagca uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua;...

13
331
0

$báo cáo hóa học:" Is tension band wiring technique the "gold standard" for the treatment of olecranon fractures? A long term functional outcome study" docx$

báo cáo hóa học:" Is tension band wiring technique the "gold standard" for the treatment of olecranon fractures? A long term functional outcome study" docx

Ngày tải lên : 20/06/2014, 01:20

... Mayo Scale (VAS) patient satisfaction score (b) Visual AnaFigure logue Elbow Performance score (MEPS) (a) and Mayo Elbow Performance score (MEPS) (a) and Visual Analogue Scale (VAS) patient satisfaction ... degeneration and olecranon fracture Elbow degeneration and olecranon fracture Mayo Type IIA fracture of the left olecranon after a fall in a 52-year-old woman (A) Lateral (B) and anteroposterior radiographs ... with a goniometer Patient-rated outcomes evaluated with the Mayo Elbow Performance Score (MEPS), Visual Analogue Scale (VAS) subjective pain score (10 = unbearable pain) and VAS patient satisfaction...

6
492
0

122PART TWO Trading System$20.70 is a good idea, because this level doesn’t show good support. docx

Ngày tải lên : 22/06/2014, 18:20

... Those are regular, narrow, and expanding Each requires a different approach and presents a different challenge We have to add that as for trend traders, a ranging market is very tough for us, and ... the relative strength of a particular stock as an indication of its being a likely candidate Also keep in mind that this approach is useful as a backup plan in trending markets As the market is ... CUP -AND- HANDLE SETUP The cup and handle is also a breakout setup and is very common for longer time frames It works best on a day’s high, although it can be applied in the middle of the daily range...

27
283
0

Báo cáo y học: "Active immunization to tumor necrosis factor-α is effective in treating chronic established inflammatory disease: a long-term study in a transgenic model of arthritis" pps

Ngày tải lên : 12/08/2014, 11:22

... experiment and at sacrifice, sera were obtained and tested for anti-KLH and anti-TNF-α antibody titers and for anti-TNF-α antibody neutralizing capacity Specific anti-hTNF-α and antiKLH antibody ... group, inflammation (b) and destruction (d) were scored at Black arrows show thickness and inflammatory infiltration of synovial membrane in (b) and a normal appearance in (a) White arrows show ... work also received financial support from Neovacs SA (Paris, France), Debiopharm SA (Lausanne, Switzerland), Agence Nationale de la Recherche (ANR), Institut National de la Santé et de la Recherche...

10
282
0

Báo cáo y học: " Activation instead of blocking mesolimbic dopaminergic reward circuitry is a preferred modality in the long term treatment of reward deficiency syndrome (RDS): a commentary" potx

Ngày tải lên : 13/08/2014, 16:21

... Shahmoradgoli Najafabadi M, Ohadi M, Joghataie MT, Valaie F, Riazalhosseini Y, Mostafavi H, Mohammadbeigi F, Najmabadi H: Association between the DRD2 A1 allele and opium addiction in the Iranian ... release at the NAc Gabapentin is a gamma-aminobutyric acid (GABA) analogue, with GABAmimetic pharmacological properties Gabapentin is used for the treatment of seizures, anxiety and neuropathic ... increase (approximately 50%, p < 0.05) in extracellular NAc GABA levels, but failed to alter either basal or cocaine-enhanced NAc DA These data suggest that Gabapentin is a weak GABA-mimic drug At the...

16
405
0

Báo cáo y học: "Long-term outcome of a randomized controlled universal prevention trial through a positive parenting program: is it worth the effort" pot

Ngày tải lên : 13/08/2014, 18:21

... the acquisition of data and supervision of data collection as well as to analyzing the behavior observation data All authors read and approved the final manuscript Acknowledgements This study was ... problems and make these interventions broadly available to parents The Triple P system is widely spread internationally and has been well evaluated A Page of 14 recent meta-analysis by Nowak and Heinrichs ... efficacy single mothers Table shows the means, standard deviations, intragroup, and inter-group effects sizes for the parenting and child measures at pre- and post-intervention, and at the and year...

14
241
0

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Ngày tải lên : 03/11/2012, 11:44

... (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes) All patients AVNRT ... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily ... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized...

9
679
0

Tài liệu The long-term reproductive health consequences of female genital cutting in rural Gambia: a community-based survey doc

Ngày tải lên : 13/02/2014, 16:20

... speculum examination and bimanual pelvic palpation Vaginal swabs were taken and tested for Trichomonas vaginalis (TV), bacterial vaginosis (BV de®ned as Nugent score of 7+) and Candida albicans (semicon¯uent ... confounders age, parity and marital status Polygamy is common in the study area, so the marital status variable differentiated between monogamous and polygamous marriages The statistical analysis was ... 0.05§ Values in brackets denote percentages *Adjusted for age, marital status and parity From likelihood ratio test adjusting for age, marital status and parity àAdjusted for age and marital status...

11
558
0

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20

... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... of the mouse, and will accelerate the molecular and cellular analysis of ECs and their heterogeneity in various vascular beds 1994 Construction of the transgene Total RNA was extracted using TRIzol...

11
873
0

Tài liệu Pension Fund Indicators 2012 A long-term perspective on pension fund investment docx

Ngày tải lên : 19/02/2014, 14:20

... them may go down as well as up, and investors may not get back the original amount invested UBS Global Asset Management (UK) Ltd is a subsidiary of UBS AG Registered in England and authorised and ... Equities and Fixed Income, where specialist mandates can be run on an active or passive basis Global Investment Solutions (GIS) covers asset allocation, currency, manager research and risk management ... Our other investment and business areas are Alternative and Quantitative Investments, Global Real Estate, Infrastructure, Private Equity and Fund Services UBS Global Asset Management combines investment...

12
359
0

Long-term Exposure to Traffic-related Air Pollution and Type 2 Diabetes Prevalence in a Cross-sectional Screening-study in the Netherlands pdf

Ngày tải lên : 06/03/2014, 19:20

... all national, provincial and municipal authorities in the study area and were linked to a digital map of all roads in the Netherlands (NWB), using GIS Other land use data were obtained from a ... ArcInfo (ESRI, Redlands, CA) Statistical analyses Participants with missing values on exposure variables and the covariates age, gender and income were excluded from all analyses We used penalized ... of data; drafted and revised the article and approved the final version KvdH, MA, RvS, GH substantially contributed to design and interpretation of data, revised the article critically and approved...

9
771
0

''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf

Ngày tải lên : 07/03/2014, 17:20

... phone calls and instant messages from an anonymous source began claiming that the Majestic fire was arson and part of a larger and dangerous conspiracy Thus began the "real" game, which had cleverly ... mini-flash games to advance plot and player status These games, played on cell phones or the Web, have a symbolic diegetic meaning — for instance, a player manipulates an avatar through a flash ... interpreting plot developments and evidence that circulated mostly through Web sites and emails, but also through phone calls, faxes, television and newspaper ads, as well as occasional real-time and offline...

10
583
0

Assuring Access in Key Strategic Regions - Toward a Long-Term Strategy docx

Ngày tải lên : 15/03/2014, 20:20

... anti-access study with us xxi Glossary AB AMC APOD APOE APS ARCENT ARPAC ARSOUTH ASAT ASW ATACMS AWACS BCT C2 CBRNE CENTCOM CEP CONUS EMP Air Base Air Mobility Command Aerial Point of Debarkation ... • “Anti-Access in a Baltic Scenario,” 2003; “Anti-Access in a SWA Scenario,” 2003; “Anti-Access in a PRC-Taiwan Scenario,” 2003; and “Anti-Access Strategies: A Quantitative Analysis of Military ... to APODs and SPODs, and onward movement toward the tactical area Our assumption was that, in theory at least, an adversary could direct attacks or other actions against any of the nodes or arcs...

187
251
0

Báo cáo khoa học: Mitochondria regulate platelet metamorphosis induced by opsonized zymosan A – activation and long-term commitment to cell death docx

Ngày tải lên : 16/03/2014, 04:20

... treated platelets with lm calcein-AM (Molecular Probes) at 37 °C for 30 Activation of caspases The activation state of caspases and was evaluated using a CaspGLOW fluorescein active caspase staining ... induce caspase activation Analysis of the activation state of caspases and in intact living platelets treated with zymosan (A) or opsonized zymosan (B) at various time points (C) Activation state ... and caspase activation [30] The activation state of caspase was also verified by western blot analysis using a specific antibody (Santa Cruz) Immunoreactive bands were visualized using a secondary...

12
309
0

Báo cáo khoa học: Mitochondria regulate platelet metamorphosis induced by opsonized zymosan A – activation and long-term commitment to cell death potx

Ngày tải lên : 16/03/2014, 04:20

... (Tokyo, Japan) Malantide (internal standard, ‡ 97%) was purchased from Sigma-Aldrich (Steinheim, Germany) Ammonium acetate (> 98%) was obtained from Merck (Darmstadt, Germany), and high-purity water ... superfamily (Table 2) Chitosanase as a resistance determinant against antimicrobial action of chitosan The ﬁnding that a heterologous chitosanase can protect E coli against the antimicrobial activity ... 31 32 of a bacterial family 19 chitinase reveal differences from plant enzymes FEBS J 273, 4889–4900 Akiyama K, Fujita T, Kuroshima K, Sakane T, Yokota A & Takata R (1999) Puriﬁcation and gene...

13
382
0

A YEAR OR MORE: The high CosT of Long-Term UnempLoymenT potx

Ngày tải lên : 17/03/2014, 08:20

... february 2010, 13 states and the District of Columbia had an unemployment rate higher than 10 percent, and six states (California, florida, michigan, nevada, rhode island, and south Carolina) had ... Situation, Table A- 12 (march 2010) This rate is seasonally adjusted U.s Department of Labor, Bureau of Labor statistics, Historical Data, Table A- 12 21 U.s Department of Labor, Bureau of Labor ... Walton wrote this report with research assistance from evgeni Dobrev and background analysis from sarah nolan The report was reviewed by all team members, Joanna Breslow, pete Janhunen, samantha...

22
330
0