delivery of ward stock

Tài liệu Guidelines for the appointment of General Practitioners with Special Interests in the Delivery of Clinical Services pdf

... development of a GPwSI service The activities of a GPwSI service will depend on a number of factors, including the location of the service and its overall aims In principle ,the main activities of the ... Good understanding of roles, responsibility and structure of PCOs and how to influence them to bring about improvement in delivery of sexual health services Understanding of primary care structures ... and how these may affect delivery of services within the PCO Understanding of service redesign and care pathways Knowledge of local educational providers Indicators of sexual health risk Skills...

11
489
0

Tài liệu ‘Unheard voices’: listening to Refugees and Asylum seekers in the planning and delivery of mental health service provision in London. pptx

Danh mục: Kỹ năng nghe tiếng Anh

... professionals involved in the planning, delivery and funding of services need to acknowledge the range of problems and issues experienced by those living in exile By taking a wide perspective of ... perception of the situation Clients have said “I'm not mad, I don't need counselling’ (NHS worker) 'A lot of people don't want to engage because of shame or because of their perception of the situation' ... said that individuals are wary of accessing services and often want to access them out of the borough’ The problem of gaps in service provision Asked why the provision of mental health services for...

92
1,134
0

Báo cáo khoa học: Efﬁcient and targeted delivery of siRNA in vivo pdf

Danh mục: Báo cáo khoa học

... muscle via local delivery, whereas systemic siRNA delivery is the only way to reach metastatic and hematological cancer cells Local delivery offers several advantages over systemic delivery, such ... showed robust protection of the animals from lethal infection Intracellular siRNA delivery In many aspects, siRNA delivery is similar to that of delivering other types of nucleic acids such as ... delivery Cell-penetrating peptides (CPPs), short cationic polypeptides with a maximum of 30 amino acids, have been extensively used to obtain enhanced intracellular delivery of a wide range of...

14
599
0

CURRENT TECHNOLOGIES TO INCREASE THE TRANSDERMAL DELIVERY OF DRUGS” pdf

Danh mục: Sức khỏe giới tính

... because of the cohesion of the cells of its more superficial layers; a firm and supple skin because of the existence of a dense supportive tissue and of the presence of numerous elastic fibers of ... [41] ROUTES OF PENETRATION OF DRUGS The determination of penetration pathways of topically applied substances into the skin is the subject of several investigations The permeation of drugs through ... enhancer of hydrophilic permeants, but is less effective at promoting the transdermal delivery of lipophilic agents [6] Urea Urea is one of the components of the natural moisturising factor (NMF) of...

155
421
0

The sensitivity of bank stock returns to market, interest and exchange rate risks docx

Danh mục: Ngân hàng - Tín dụng

... nominal rate of return on stocks, R=E+SF+t, (1) where R is a vector of the nominal rate of stock returns at time t, E is a vector of expected stock returns at time t, F is a vector of risk factors ... sensitivity of the rates of return of common stocks of large US banking institutions to interest rate, exchange rate and market risk factors Consideration of exchange rates as a factor affecting bank stock ... Sensitivity Estimation of bank stock returns 1001 of factor risk premia For the sample of banks used in this study the above analysis establishes the significance of the sensitivity of bank stock returns...

22
331
0

Báo cáo khoa học: The speciﬁc delivery of proteins to human liver cells by engineered bio-nanocapsules doc

Danh mục: Báo cáo khoa học

... Conditioned medium of nontransfected Cos7 cell (a), ng of BNC from the conditioned medium (b), 100 ng of EGFP (c) and a mixture of ng of BNC with 100 ng of EGFP (d), and ng of L(n45)-FLAG-EGFP ... potential to form a particle Topology analysis of the C-terminus of L fusion protein Consisting of 56 amino acids, the primary structure of the C-terminus of the S region is rich in hydrophobic residues ... the results of previous studies of the topology of the HBsAg protein It is suggested that the C-terminus of the envelope protein protrudes from the particle in 1987 [12] Localization of HBV epitope...

10
373
0

the delivery of regenerative medicines and their impact on healthcare - c. prescott, d. polak (crc, 2011) ww

Danh mục: Kỹ thuật lập trình

... preclinical proof of concept; (2) evidence of safety; and (3) early indications of benefit and efficacy (Phase I/IIA or B human clinical trials) A high level of predictability of a continuing chain of funding ... now an emeritus professor from the Faculty of Medicine and resides in an office in the Department of Chemical Engineering She is also a member of the Scientific Advisory Board of the Imperial College ... understanding and nvesting in the delivery of i regenerative medicines to the benefit of patients Professor Lord Ara Darzi, KBE, HonFrEng FmedSci Professor of Surgery, Oncology, Reproductive...

414
1,575
0

protest of the ukrainian republic to the united states against the delivery of eastern galicia to polish domination. washington d. c., 1919

Danh mục: Tổng hợp

... peace "II The settlement of every question, whether of territory, of sovereignty, of economic arrangement, or of political relationship, upon the basis of the free acceptance of that settlement by ... and shooting of priests, and the most inhuman treatment of Ukrainian prison- war (684 prisoners of war died during a period 30 days in a single camp out of a total of six or ers of of eight thousand) ... ruins of old Russia Galicia, part of Northern Against the exercise of this right of self-determination has arisen Poland, attempting to conquer Eastern Galicia by force of arms During the course of...

28
400
0

báo cáo hóa học:" Effective transvascular delivery of nanoparticles across the blood-brain tumor barrier into malignant glioma cells" docx

Danh mục: Hóa học - Dầu khí

... Proceedings of the National Academy of Sciences of the United States of America 1982, 79:5292-5296 Gear ARL: Rhodamine 6G A potent inhibitor of mitochondrial oxidative phosphorylation Journal of Biological ... half-lives compared to Gd-dendrimers of higher generations The blood concentration profile of lowly conjugated Gd-G4 dendrimers was similar to the profiles of Gd-G1, Gd-G2 and Gd-G3 dendrimers ... dendrimers are larger than the upper limit of the physiologic pore size of the BBTB of RG-2 gliomas Using ADF STEM, we measured the diameters of a population of our Gd-G8 dendrimers to be 13.3 ± 1.4...

15
432
0

Báo cáo sinh học: " Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA" ppt

Danh mục: Điện - Điện tử

... The mode of introduction of siRNA affects the ability to establish RNAi Based on the timing experiments, the establishment of resistance to RNAi correlated with the onset of WNV RNA Page of 13 (page ... resistance Nonetheless, it is possible that the method of delivery independently affects the ability of the siRNA to prime the RNAi response The route of delivery differs between TKO transfection and ... Quantitation of Lineage II genome was performed using a primer set directed towards the 3' UTR of the Lineage II WNV genome (forward primer 5'AGAGTGCAGTCTGCGATAGTGC; probe 5' FAM Page 11 of 13 (page...

13
340
0

báo cáo hóa học:" Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA" pptx

Danh mục: Hóa học - Dầu khí

... The mode of introduction of siRNA affects the ability to establish RNAi Based on the timing experiments, the establishment of resistance to RNAi correlated with the onset of WNV RNA Page of 13 (page ... resistance Nonetheless, it is possible that the method of delivery independently affects the ability of the siRNA to prime the RNAi response The route of delivery differs between TKO transfection and ... Quantitation of Lineage II genome was performed using a primer set directed towards the 3' UTR of the Lineage II WNV genome (forward primer 5'AGAGTGCAGTCTGCGATAGTGC; probe 5' FAM Page 11 of 13 (page...

13
260
0

Báo cáo hóa học: " Efficient data replication for the delivery of highquality video content over P2P VoD advertising networks" pdf

Danh mục: Hóa học - Dầu khí

... on the best-effort delivery service in the form of UDP (the size of the UDP datagram is limited to 1,500 bytes), which does not guarantee reliability or the delivery order of network packets ... approximation of the RTT as the measure of end-to-end latency, and the forward and backward path using an independent time-invariant packet erasure channel with random delay The RTT between a pair of peers ... probabilities of packet loss on the forward and backward channel are denoted by μf and μb, respectively If peer A1 sends a PING packet on the forward channel at time t, μf is the probability of packet...

18
546
0

Báo cáo hóa học: " Functionalized halloysite nanotube-based carrier for intracellular delivery of antisense oligonucleotides" pdf

Danh mục: Hóa học - Dầu khí

... PBS, dehydrated through a series Page of of alcohol concentrations (30%, 50%, 70%, 90%, 100%), embedded in Epon, and sliced to a thickness of 70 nm Images of the sliced images were recorded at ... the percentage of fluorescent cells out of the total number of cells Fluorescence was detected from the FAM labeled on ASODNs at 488-nm excitation In vitro cell toxicity assay of the f-HNT-ASODN ... formation of f-HNT-ASODN complexes After adsorption of ASODNs, the surface zeta potential of the f-HNT-based complexes decreased to a less positive value, suggesting the successful conjugation of DNA...

7
299
0

Báo cáo hóa học: " Nanoliposomes for encapsulation and delivery of the potential antitumoral methyl 6-methoxy-3-(4methoxyphenyl)-1H-indole-2-carboxylate" doc

Danh mục: Hóa học - Dầu khí

... Braga, Portugal 2Centre of Chemistry (CQ/UM), University of Minho, Campus de Gualtar, 4710-057 Braga, Portugal 3Laboratory of Microbiology, Faculty of Pharmacy and Centre of Medicinal Chemistry ... concentrations that were able to cause 50% of cell growth inhibition (GI50) are summarized in Table Page of Table Values of compound concentration needed for 50% of cell growth inhibition (GI50) GI50 ... compound Further developments of the present study will involve assays of liposome cell internalization and mechanism of action, keeping in mind the application of this compound as an antitumoral...

6
323
0

Báo cáo hóa học: "Preparation and evaluation of novel mixed micelles as nanocarriers for intravenous delivery of propofol" potx

Danh mục: Hóa học - Dầu khí

... for propofol, which exhibits rapid sleep and recovery Page of 0.5 of dose administration) following administration of both of propofol formulations (data not shown) The results of recovery of righting ... mPEGPLA/Solutol HS15/propofol of 10/1/5 by weight, average micelle size of about 101 nm and PDI of 0.12 as shown in Figure The LC of mixed micelles was about 32.4%, and the content of propofol in the preparation ... comparison of the profiles of propofol release from the Li et al Nanoscale Research Letters 2011, 6:275 http://www.nanoscalereslett.com/content/6/1/275 Figure Release profile of propofol from...

9
573
0

Báo cáo hóa học: " Oral Delivery of DMAB-Modified DocetaxelLoaded PLGA-TPGS Nanoparticles for Cancer Chemotherapy" potx

Danh mục: Hóa học - Dầu khí

... 3College of Pharmacy, Dalian Medical University, 116027 Dalian Liaoning, People’s Republic of China 4Key Laboratory of Functional Polymer Materials, Ministry of Education; Institute of Polymer ... nanoparticles (BNP) Such advantages of the nanoparticle formulations can be contributed to the effects of TPGS and DMAB component of the nanoparticles in enhancing cellular uptake of the nanoparticles (2) ... for the Shenzhen Key Lab of Gene & Antibody Therapy and for Upgrading the Construction of Shenzhen’s National Key Lab of Health Science & Technology Author details School of Life Sciences, Tsinghua...

10
249
0

Báo cáo hóa học: " Intestine-Specific, Oral Delivery of Captopril/ Montmorillonite: Formulation and Release Kinetics" pdf

Danh mục: Hóa học - Dầu khí

... attributed to the –OH stretch of Al– OH and that of Si–OH [25] The –OH bending mode Figure FT-IR spectra of CP, MMT and of CP-MMT systems of absorbed water is evidenced as a series of overlapping bands ... were of analytical grade Preparation of CP-MMT Systems Three methods (solution, melt and grinding) were employed for the intercalation of CP into the MMT Figure Schematic representation of intercalation ... exponent Values of n between 0.5 and 1.0 are indicative of anomalous, non-Fickian, kinetics [26] Characterization The concentration of CP was determined from calibration plots of absorbance (SHIMADZU...

8
346
0

THE DELIVERY OF NANOPARTICLES doc

Danh mục: Tự động hóa

... cofactor They mentioned high stability of nanoparticles in solution was due to capping of particles by 12 The Delivery of Nanoparticles release of capping proteins by F oxysporum Stability of ... out the novels of discoveries In the last few years, the reality of nanotechnology has changed the dimensions of the world of science and dramatically explored the 3D piece of art of the new tiny ... list of science fields is inserted in the list of near future confrontation and to study the possibility of converting the conventional roles of science to explore the art beauty of the use of...

552
298
0

The New Laws of the Stock Market Jungle pot

Danh mục: Tài chính doanh nghiệp

... events, while terrible for those involved, often have little direct impact on most people’s lives Part of The New Laws of the Stock Market Jungle reviews many of the signiﬁcant developments that have ... growth of “alternative” investing Part contains Chapters through 10, which explore and dissect each of the 10 New Laws of the Stock Market Jungle Each chapter sets forth a description of the ... with a solid understanding of what goes on in the underbelly of the market, and with the beneﬁt of my 20 years of institutional trading and investing experience, those of you with a thoughtfully...

316
333
0