0

debris disposal and recycling for the cedar and paradise wildfires in san diego

The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products

The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products

Sinh học

... phosphine is a quick and effective tool for the control of stored-product insect pests In view of the scheduled phaseout of methyl bromide under the Montreal protocol, the role of phosphine in grain ... (=20 g m−3 ) and exposure time of day were not effective in killing the insects at the bottom of the column when the fumigant was applied at the upper layer of the grain Addition of CO2 and circulation ... protection has increased and stands as the main alternative to methyl bromide Lately, insect resistance to phosphine has become an important issue for effective grain treatment (Nakakita and Winks, 1981;...
  • 20
  • 483
  • 0
Alternative Processing Technologies for the Control of Spoilage Bacteria in Fruit Juices and Beverages

Alternative Processing Technologies for the Control of Spoilage Bacteria in Fruit Juices and Beverages

Môi trường

... properly before processing is among the main reasons for contamination in fruit juice Washing and brushing fruit before the juicing step is common in juice processing According to one industry ... practices using chlorine and brushing only may be partially effective in controlling microbial contamination.9 The pathogens contaminating the fruit are not always located on the surface20 and are ... potential for microbiological contamination, including contamination with E coli, and therefore should be avoided.11–13 Another important source of E coli O157:H7 infections is drinking water...
  • 21
  • 691
  • 2
New ESPGHAN guidelines for the diagnosis of Coeliac Disease in Children and Adolescents pptx

New ESPGHAN guidelines for the diagnosis of Coeliac Disease in Children and Adolescents pptx

Sức khỏe trẻ em

... CD without increasing the risk of misclassification Preconditions are • • • • high quality serology including EMA taking quantitative antibody levels into account HLA typing full information to ... gluten and related prolamines  in genetically (mainly HLA) susceptible individuals  characterized by a combination of: • gluten dependent clinical manifestations • anti-tissue transglutaminase ... criteria for clinical decisions Formulate an answerable question Track down the best evidence Critically appraise the evidence for • Validity • Impact (size of the benefit) • Applicability Integrate...
  • 33
  • 537
  • 0
Báo cáo

Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Báo cáo khoa học

... assumed  suddenly  increases  at  the breaking  point,  then  gradually  increases  towards  the shore,  and then decreases with the decrease in the water  depth in the following form:  ⎛ hm ⎞ ... Fig. 1. The coordinate system and method for the evaluation of a wetting and drying boundary.  The procedure  for determining  the cell  side  wetted  function  and the cell  area  wetted  function  in the numerical  ... of  the lost  wave  energy  is  transformed  into  turbulence  energy.  At  the beginning  of  the wave  breaking  process,  the turbulence  is  confined into a small portion of the breaking ...
  • 11
  • 460
  • 0
semantic web for the working ontologist effective modeling in rdfs and owl

semantic web for the working ontologist effective modeling in rdfs and owl

Đại cương

... something in your personal domain In the Semantic Web, Anyone can say Anything about Any topic Explore the freedom Second Printing: Since the first printing there have been advances in several of the ... an informal organization to a large body of heterogeneous information The organization is informal in the sense that the interpretation of the tags requires human processing in the context of the ... rely on their own experience and knowledge in evaluating and using any information, methods, compounds, or experiments described herein In using such information or methods they should be mindful...
  • 369
  • 2,133
  • 1
Báo cáo toán học:

Báo cáo toán học: "Invariant and coinvariant spaces for the algebra of symmetric polynomials in non-commuting variables" pps

Báo cáo khoa học

... the trivial representation s6 being the span of m222 inside Λ 4.3 Λ meets S S We begin by explaining the choice of normalizing coefficient in (16) Analyzing the abelianization map ab : T → S (the ... µr ) and ν = (ν1 , ν2 , , νs ) with r ≤ s, then the partition indexing the left-most term in mµ mν is denoted by µ ∪ ν and is given by sorting the list (µ1 , , µr , ν1 , , νs ) in increasing ... structural features of S and T Section describes the place-action structure of T and the original motivation for our work Our main results are proven in Sections and We underline that the harder part...
  • 17
  • 364
  • 0
báo cáo khoa học:

báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

Báo cáo khoa học

... appropriate material for examining the temporary cavity The present model provides significant findings in the field of terminal wound ballistics and permits conclusions to be drawn about the surgical ... out CT and CBCT scans for clinical and systematic analyses; but the potential for systematic testing offered by gelatin blocks is far from having been fully exploited The present paper therefore ... the left) The gelatin blocks were fixed directly behind the dust chamber in the direction of fire The tests were performed with gelatin blocks (n = 12) They consisted of 20% porcine gelatin (Merck,...
  • 5
  • 573
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt

Báo cáo khoa học

... designed and coordinated the study and carried out the genetic analysis All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... CTTCATTTGTTATTCGACTT) and PVM2 (Forward: ATGGGAGATTCAACRAAGAA) were used for amplifying the entire CP gene and the nucleotide sequences of the amplicons (917 bp) were then determined in both directions using the ... tubers without the need to treat the tubers for breaking dormancy or to grow the tubers in greenhouse for leaf testing by ELISA In this paper we report on the analysis of the coat protein (CP) gene...
  • 7
  • 452
  • 0
Báo cáo y học:

Báo cáo y học: "A unified framework of immunological and epidemiological dynamics for the spread of viral infections in a simple network-based population" ppt

Báo cáo khoa học

... load, Av (t), in the population was the integral of the mean viral load from the beginning of a given simulation (time 0) until time t, and was used as a proxy for the final size and severity ... not for citation purposes) Theoretical Biology and Medical Modelling 2007, 4:49 Varying the infecting dose The outcome of viral infection, in general, is thought to be related to the size of the ... extinct within a person, any finite-rate perturbations to the viral load in that individual disease free equilibrium will be insufficient to elevate their viral load, and will therefore maintain...
  • 13
  • 334
  • 0
Relevance of mineral nutrition and light quality for the accumulation of secondary metabolites in centella asiatica and hydrocotyle leucocephala

Relevance of mineral nutrition and light quality for the accumulation of secondary metabolites in centella asiatica and hydrocotyle leucocephala

Tổng hợp

... leaf The comparison of the red and UV excitation quantifies the screening effect due to polyphenols and therefore the content of the latter in the epidermis (modified after Force-A, 2010) The ... at the expense of centelloside synthesis Therefore, the objectives of the present study were to examine the significance of N, P, or K supply for herb and leaf production and for saponin and ... ()-matairesinol, and finally ()-hinokinin originates from the generation of two methylenedioxy bridges, either via ()-pluviatolide or via ()-haplomyrfolin, depending on the benzene ring on which the first...
  • 149
  • 319
  • 0
Utilization of activated carbon for the removal of basic dyes in fixed-bed microcolumn

Utilization of activated carbon for the removal of basic dyes in fixed-bed microcolumn

Môi trường

... using the smaller microcolumn Decreasing initial dye concentration, and adsorbent particle size and increasing column diameter enhanced the column performance and resulted in an increase in the ... with the increase in column diameters The Thomas model correlates the experimental data quite well as it can be seen in Figure The enhancement in the column performance with the increase in the ... breakthrough point from 145 to 269 (cm3) and delayed the time for the breakpoint to occur from 72 to135 (min) The results in Table attested to this trend as it is evident from the increase in the bed...
  • 10
  • 561
  • 0
Using games for the 10th form speaking clas in high school (the new textboook) = sử dụng trò chơi trong giờ học nói tiếng anh lớp 10 ở trường trung học phổ thông   SGK mới

Using games for the 10th form speaking clas in high school (the new textboook) = sử dụng trò chơi trong giờ học nói tiếng anh lớp 10 ở trường trung học phổ thông SGK mới

Công nghệ thông tin

... meaning that involves producing and receiving and processing information (Brown, 1994, Burn and Joyce, 1997) Its form and meaning are dependent on the context in which it occurs, including the participants ... Analysis After investigating the teachers and the students by using the survey questionaires, the answers gained bring some sort of interesting and truthful information concerning the matter under ... students and make them active and dynamic in studying 1.3.4 Difficulties for Teachers in Using Games in Speaking Class As mentioned above, using games in language classroom in general and in speaking...
  • 59
  • 2,358
  • 5
Tài liệu Báo cáo Y học: Role of sulfoquinovosyl diacylglycerol for the maintenance of photosystem II in Chlamydomonas reinhardtii ppt

Tài liệu Báo cáo Y học: Role of sulfoquinovosyl diacylglycerol for the maintenance of photosystem II in Chlamydomonas reinhardtii ppt

Báo cáo khoa học

... binding to the relatively hydrophobic QB pocket, which is the exit of the electron flow in the PSII complex According to the increase in the sensitivity to diuron in hf-2, the limitation of the ... condition The supplementation of SQDG in the medium enabled the mutant to grow even in the presence of diuron (Fig 3) The exogenously applied SQDG is incorporated into the mutant cells in the form ... 3/10HSM (B) 3/10HSM containing diuron, and (C) 3/10HSM containing both diuron and 100 lM SQDG We then measured the PSII activity in hf-2 cultured in the presence of SQDG (Fig 5) Inhibition of PSII...
  • 6
  • 500
  • 0
FAQs Tuberculosis Component of the Technical Instructions (TIs) for the Medical Examination of Aliens in the United States doc

FAQs Tuberculosis Component of the Technical Instructions (TIs) for the Medical Examination of Aliens in the United States doc

Sức khỏe giới tính

... of Aliens in the United States for all non-TB portions of the medical examination (other infectious diseases, mental health conditions, etc.), except for vaccinations For the latter, there are ... does not involve the lungs Completion of treatment for Class B1-Extrapulmonary TB is not required for the civil surgeon to sign the I-693 form As regards the TB, the signature indicates the applicant ... Technical Instructions should the civil surgeon follow for the non-TB portions of the medical examination? The civil surgeon should follow the 1991 Technical Instructions for Medical Examination...
  • 8
  • 474
  • 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Báo cáo khoa học

... Furthermore, the microsomal fraction proteins were incubated 15 in binding buffer at temperatures ranging from 20 to 70 °C before performing the binding experiment The results show that the binding ... only one toxin molecule per binding site) PA1b seems to bind to a single protein, as only one binding site is detectable in the microsomal fraction, and the binding activity in the 3000 and 10 000 ... strong binding capacity The determination of the characteristics of the binding site of these different strains or species is presented in Table The binding activities of extracts from the five...
  • 7
  • 604
  • 0
Student Handbook for the Master of Science Programs in: Business & Management pdf

Student Handbook for the Master of Science Programs in: Business & Management pdf

Cao đẳng - Đại học

... Period and Format The thesis work can take place both in the spring or in the fall The thesis work starts at the beginning of the semester and ends at the end of the semester The examiner can ... Handbook for the MBM, MECON & MFINA Programs The preferred format is that the students work in pairs In addition to writing and submitting the thesis, examination requirements for the Master thesis ... solutions and communicate these problems and solutions in a wellstructured and convincing way Starting in 2013, a specialization in International Business (combined with the CEMS Master in International...
  • 66
  • 723
  • 0
MECHANICAL ENABLING FOR THE INTEL@ PRNTIUM 4 PROCESSOR IN THE 478-PIN PACKAGE pdf

MECHANICAL ENABLING FOR THE INTEL@ PRNTIUM 4 PROCESSOR IN THE 478-PIN PACKAGE pdf

Kĩ thuật Viễn thông

... Mechanical Enabling Reference Design is: Intel-developed enabling solution for the Intel® Pentium® processor in the 478-pin package and the Intel® 845 MCH Developed for general industry use Targeted ... Processor 478-Pin Socket (mPGA478) Design Guidelines Assembling Intel Reference Components for the Intel® Pentium® Processor in the 478-Pin Package The following collateral is available in the Chipset ... responsible for the design, sale and functionality of its product, including any liability arising from product infringement or product warranty and Intel assumes no liability for vendor products, either...
  • 25
  • 361
  • 0
ag doped wo3-based powder sensor for the detection of no gas in air

ag doped wo3-based powder sensor for the detection of no gas in air

Vật lý

... patterns (the lack of their long-range order and their heterogeneity may explain the poor re¯ection hump obtained in XRD) Typically, as seen in the ®gure, a region containing ca Ê 6.93 A inter-planar ... However, there is limited work reported in the literature on addressing the precise sensing mechanism for the NOx gases detection over WO3-based sensors and there is no work to reveal the roles of the ... defective sites on the WO3 at and near the interface between the small Ag particles and the bulk WO3 particles as indicated by the present XRD and the TEM results A detailed study on the WO3 promoted...
  • 8
  • 502
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25