d c potentials of the cerebral cortex

evolutionary developmental biology of the cerebral cortex - novartis foundation

evolutionary developmental biology of the cerebral cortex - novartis foundation

Ngày tải lên : 08/04/2014, 12:56
... cortex depends on several factors, including the number of founder cells, the time of onset of corticogenesis, the duration of the cell division cycle, the duration of the period of neurogenesis, the ... resemble cerebral cortex, they perform the same kinds of function The cerebellum has therefore independently expanded in birds and reptiles compared to mammals in accordance with the expansion of the ... embryonic cortex led to the radial unit hypothesis which postulates that the size of the cerebral cortex depends on the number of contributing radial units, which in turn depends on the number of...
  • 282
  • 303
  • 0
Curcumin modulates dopaminergic receptor, CREB and phospholipase c gene expression in the cerebral cortex and cerebellum of streptozotocin induced diabetic rats potx

Curcumin modulates dopaminergic receptor, CREB and phospholipase c gene expression in the cerebral cortex and cerebellum of streptozotocin induced diabetic rats potx

Ngày tải lên : 10/08/2014, 05:21
... binding against dopamine in the cerebral cortex and cerebellum of control and experimental rats The Scatchard analysis showed that the Bmax and Kd of the [3H] dopamine receptor binding decreased ... group D + I- Insulin treated diabetic rats D+ C- Curcumin treated diabetic rats time that STZ-induced diabetes produces a marked attenuation of cerebral cortical and cerebellum function mediated through ... receptors, CREB and phospholipase C in the cerebral cortex and cerebellum of STZ-induced diabetic rats Our present study on curcumin dependent regulation of dopaminergic receptors, transcription factor...
  • 11
  • 413
  • 0
Báo cáo khoa học: " Expression of tyrosine kinase A in the cerebral cortex of postnatal developing rat" docx

Báo cáo khoa học: " Expression of tyrosine kinase A in the cerebral cortex of postnatal developing rat" docx

Ngày tải lên : 07/08/2014, 18:21
... ni dnuof erew sllec RI-AkrT ,V reyal ot noitidda nI III dna II ,I reyal otni decart eb dluoc hcihw ,)2 giF( 004× )51DP (D ,)9DP (C ,)6DP(B ,)3DP(A depoleved ton llew erew sessecorp tub ,desaercni ... rednu dehpargotohp dna deweiv erew noitceS deppilsrevoc dna enelyx ni deraelc ,slonahte fo seires dedarg a hguorht detardyhed ,sedils detaoc -nitaleg no detnuom erew noitces eht ,ypocsorcim thgil ... tpecxe evoba debircsed sdohtem eht ot gnidrocca detaert erew snoitces eht ,slortnoc eseht fo owt nI demrofrep erew snoitcaer lacimehcotsihonummi eht rof slortnoc eerhT lortnoC dleifthgirb rednu...
  • 5
  • 298
  • 0
Báo cáo y học: "Enhanced glutamate, IP3 and cAMP activity in the cerebral cortex of Unilateral 6-hydroxydopamine induced Parkinson’s rats: Effect of 5-HT, GABA and bone marrow cell supplementation" ppsx

Báo cáo y học: "Enhanced glutamate, IP3 and cAMP activity in the cerebral cortex of Unilateral 6-hydroxydopamine induced Parkinson’s rats: Effect of 5-HT, GABA and bone marrow cell supplementation" ppsx

Ngày tải lên : 10/08/2014, 05:21
... study showed an increased activity of bax gene expression in the cerebral cortex of the 6-OHDA infused rats which indicated the ROS mediated neurodegeneration in the cerebral cortex Bax, one of ... (Empower software) interfaced with the detector Quantification Dopamine in the cerebral cortex Glutamate content analysis in the cerebral cortex The monoamines were assayed according to the modified ... expressed in PD which induced the up-regulation of cAMP/PKA signaling [39] In our studies we observed an elevated cAMP and IP3 level in the cerebral cortex of 6-OHDA induced rats The elevated IP3...
  • 10
  • 456
  • 0
Báo cáo y học: "Mild hypothermia alone or in combination with anesthetic post-conditioning reduces expression of inflammatory cytokines in the cerebral cortex of pigs after cardiopulmonary resuscitation" ppt

Báo cáo y học: "Mild hypothermia alone or in combination with anesthetic post-conditioning reduces expression of inflammatory cytokines in the cerebral cortex of pigs after cardiopulmonary resuscitation" ppt

Ngày tải lên : 13/08/2014, 20:21
... Resuscitation Council of Asia, and the Resuscitation Council of Southern Africa); the American Heart Association Emergency Cardiovascular Care Committee; the Council on Cardiovascular Surgery and ... Emergency Cardiovascular Care Committee, American Heart Association; Council on Cardiovascular Surgery and Anesthesia; Council on Cardiopulmonary, Perioperative, and Critical Care; Council on Clinical ... three consecutive measurements randomly assigned to the respiratory cycle was used for determination of cardiac output Cardiac index was calculated as the ratio of cardiac output/body surface area...
  • 11
  • 340
  • 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Ngày tải lên : 19/02/2014, 05:20
... bond] of the salt-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cotton effect The effect induced by the monovalent anion perchlorate (d) is reported for comparison ... native cytochrome c [26] Figure shows the effect of sulfate and selenate on acid-denatured cytochrome c, investigated A Fig Near-UV (A) and Soret (B) CD spectra of acid-denatured cytochrome c in the ... experimental conditions were as described in the legend to Fig Fig Absorbance at 695 nm of acid-denatured cytochrome c in the presence of increasing sulfate (s) and selenate (d) concentrations The optical...
  • 11
  • 487
  • 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Ngày tải lên : 21/02/2014, 01:21
... already dephosphorylated [6], as indicated by the complete inactivation induced by iodoacetamide The bromoacetyl derivatives 1a and 1c also inactivated Glc uptake by starved cells Being modified ... components other that EIIGlc can be excluded What cannot be excluded is that dephosphorylation and/or catalytic turnover of EIIGlc, rather than binding of Glc, enhanced the reactivity of Cys421 As Cys421 ... In the presence of Glc, the rates of EIIGlc inactivation by 1a and 1c increased 18-fold and 27-fold, respectively This effect of Glc is speci c for Fig Glucose-sensitized inactivation of [1 4C] sugar...
  • 12
  • 720
  • 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Ngày tải lên : 21/02/2014, 15:20
... amplified from the cDNA #911 using the following pair of primers: 5¢-CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5¢-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢ BamHI–PstI digested PCR product was cloned ... pair of primers: 5¢-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC-3¢ and 5¢-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA-3¢ EcoRI–BamHI digested PCR product was cloned as a fusion with the GAL4 activation domain ... AAAATCCACCCCACG-3¢ and 5¢-TCGGATCCC AGTGCCCACTTATTCGAAAAG-3¢ HindIII–BamHI digested PCR product was cloned into the pBlueScript SKvector and then recloned by KpnI–BamHI into the pTZ19R vector In vitro transcription...
  • 10
  • 464
  • 0
Báo cáo khoa học: Specific cleavage of the DNase-I binding loop dramatically decreases the thermal stability of actin pot

Báo cáo khoa học: Specific cleavage of the DNase-I binding loop dramatically decreases the thermal stability of actin pot

Ngày tải lên : 06/03/2014, 22:21
... [12], the nucleotide-binding cleft of ADP-G-actin cleaved within the D- loop appears to adopt the extra open conformation Comparison of the effects produced by the cleavage of the D- loop with ECP ... can be accounted for by the combined effect of phalloidin and AlF4À on the nucleotide-containing cleft Accordingly, the phalloidin-induced effect may increase the affinity of AlF4À to actin, whereas ... ATPMg-G-actins Fig DSC curves of intact G-actin (A) and ECP-cleaved G-actin (B) with different tightly bound nucleotide and cation: ATP-Ca-Gactin, ATP-Mg-G-actin and ADP-Mg-G-actin The actin concentration...
  • 11
  • 482
  • 0
Báo cáo khoa học: PKA independent and cell type specific activation of the expression of caudal homeobox gene Cdx-2 by cyclic AM pptx

Báo cáo khoa học: PKA independent and cell type specific activation of the expression of caudal homeobox gene Cdx-2 by cyclic AM pptx

Ngày tải lên : 30/03/2014, 16:20
... TGCACCACCAACTGCTTAG GCCATTCACAGGGCACATTC CCTCCTGATGGTGATGTATCGA TAACCACCGTAGTCCGGGTACT AGCGACTGTAGTGAAACTCCTTCTC AGCATCACCCATTTGATGT TCCACGACATACTCAGCAC GACGCAGGGATGATGTTC CCGGTTCCTCTTGGTGTTCA 2756 FEBS ... Mouse Cdx-2 Human CDX2 Rat GAPDH Mouse GAPDH Human GAPDH Rat proglucagon AAACCAGGACGAAAGACAAATACC GGACGTGAGCATGTATCCTAGCT CCTCGGCAGCCAAGTGAA TGATTCTACCCACGGCAAGT AACGACCCCTTCATTGAC TGCACCACCAACTGCTTAG ... expression cannot be detected in the adnomatous polyposis coli (APC) mutated colon cancer cell lines, while introducing wild type APC cDNA into an APC mutated cell line rendered it to re-express Cdx-2...
  • 14
  • 506
  • 0
Báo cáo Y học: The cytoplasmic C-terminus of the sulfonylurea receptor is important for KATP channel function but is not key for complex assembly or trafficking pdf

Báo cáo Y học: The cytoplasmic C-terminus of the sulfonylurea receptor is important for KATP channel function but is not key for complex assembly or trafficking pdf

Ngày tải lên : 31/03/2014, 08:20
... and [14]) and secondly the details of the deletions vary To try to resolve these differences we have constructed a series of deletions in the second nucleotide binding domain, expressed and studied ... lines indicated WT denotes untransfected HEK293 cells The positions of molecular mass markers (in kDa) are indicated to the left of the blot and the position of SUR1 is indicated by the arrow ... through the middle of the cell Scattered and out -of- focus fluorescent signal was removed from the image by deconvolution The image was deconvolved from a z-stack of 31 images with 0.2 lm spacing...
  • 11
  • 467
  • 0
Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt

Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt

Ngày tải lên : 31/03/2014, 23:20
... consisting of Rha and Man Although we have not studied the structure of the core saccharide, it would be made up of Gal and Glc The results of this study showed that the polysaccharide region of LPS ... great, and structural differences may affect virulence [6] Structure of lipid A moiety in LPS LPS was subjected to weak acid hydrolysis to give hydrophilic and hydrophobic products The chemical compositions ... from the nondecoupling DEPT spectrum indicating the a configuration [25] The downfield shift of C4 -a showed that a glycoside is attached at O4 of residue a [26] Residue b was assigned as b -D- mannopyranose...
  • 7
  • 437
  • 0
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 10 ppt

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 10 ppt

Ngày tải lên : 22/07/2014, 00:20
... khoá sống c n 56 Tự do: D ng c m thân 57 Dhammapada: Con đường Phật, t.4 58 Tr c gi c: Vi c biết bên logic 59 Dhammapada: Con đường Phật, t.5 60 Dhammapada: Con đường Phật, t.6 Sách Osho d ch sang ... thấy vô d ng? C c hiền nhân Upanishad nói, “Chỉ c chỗ, bên ông, nơi c a sổ chút nào.” Gạt sang bên vi c d ng gi c quan chúng tạo khung C c gi c quan c a sổ Nếu nhìn đâu với giúp đỡ c a sổ này, ... logic - đến c a hiệu c t t c vào sáng sớm để c t t c Ông c t t c xong Tiền c t t c năm mươi xu, nhà logic đưa cho ông thợ c t t c đồng ru pi Không c tiền trả lại, ông thợ c t t c bảo khách hôm...
  • 12
  • 315
  • 0
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 9 potx

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 9 potx

Ngày tải lên : 22/07/2014, 00:20
... tiện c ch th c để xuống c ch vạch để giúp cho người lên Và không m c đích ph c vụ mà vi c lên; hành trình lên không đạt tới | 341 342 | C ng phát biểu c u Phật Kinh pháp c “Ông ông nghĩ, cho c n ... toàn d c, lí cho r c rối thất vọng ham muốn d c Tâm trí đầy d c vọng nói, “Ta chìm vào toàn nhận hoan l c đầy đủ từ nó.” Nhưng khả chìm c ch toàn Nó thấy thân d ờng bị chìm hoàn toàn, th c khả ... sống bị chìm, x c chết biết bí mật vi c bơi, vi c nư c, vi c không bị chìm, mà người sống Không d ng sông nào, không đại d ơng lớn nào, nhấn chìm x c chết; lên mặt nư c Bí mật gì? X c chết gì,...
  • 21
  • 356
  • 0
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 8 ppsx

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 8 ppsx

Ngày tải lên : 22/07/2014, 00:20
... trọng cho người tìm kiếm chân lí Không c lợi vi c giao phó chúng cho kí c Chúng c lợi giữ tim Nếu chúng ghi nhớ lặp lại hàng ngày chúng trở thành c D n d n nghĩa chúng bị đi, c từ chết lại ... lừa d i trư c có khả thấy lừa d i trư c Trư c lừa d i trư c bị phá huỷ tâm trí bịa c u tr c lừa d i kh c cám d chúng ta, nói rằng, “Lại đi, nghỉ này.” Nếu ham muốn đáp ứng tâm trí định cho phép ... đèn hết d u Ngay d u đèn hết b c tiếp t c cháy lâu thêm c chút d u b c - không cháy lâu Hiền nhân hoàn c nh tương tự Ông nhận ra, “Ta tâm trí,” lửa tiếp t c cháy từ từ chút d u lại b c Hiền nhân...
  • 21
  • 343
  • 0
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 7 pdf

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 7 pdf

Ngày tải lên : 22/07/2014, 00:20
... làm điều đó, chúng khó th c hành theo đuổi Vi c thiền mà nói tới th c nghiệm với chết Nó vi c nhảy vào chết Qua vi c vào chết c ch c chủ ý, tập vi c thấy Đấy vi c th c hành tồn d ờng chết Nếu điều ... sinh ra, chúng hỏi c u hỏi Nhưng chúng c thông tin chắn chúng hỏi người chết Cho nên bạn giấu diếm bư c này, vi c sinh, che giấu với trẻ con, chúng hỏi c u hỏi này; chúng chưa bao c hội để ... thể hợp thành C hai c nửa vật chất bên chúng, c hấp d n mạnh mẽ chúng lẫn C c nửa kéo lẫn vào l c Chúng muốn toàn thể, c hấp d n c c lớn chúng Đây lí trẻ sinh vào thời m c cho tất huấn thị...
  • 21
  • 374
  • 0
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 6 ppt

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 6 ppt

Ngày tải lên : 22/07/2014, 00:20
... th c ăn, nhà c a, thu c thang vân vân - c sẵn cho Chúng ta c tất nó, sống trôi qua d chịu, thoải mái Nhưng sẵn cho Và cho d avidya c thành c ng vi c ngăn c n chết, không sẵn c Khoa h c đại ... kh c Mỗi người phải tự định cho thân c n thiết, tương ứng với c u tr c tổ ch c riêng C c gi c quan nhanh chóng đưa c nh báo r c rối bệnh tật xảy đến C c gi c quan nhạy c m nhanh chóng c nh báo cho ... người, nhu c u tận hưởng d c toàn thể giới loài vật theo chu kì C thời kì vật đòi hỏi tận hưởng d c, sau khoảng chu kì th c thoả mãn d c Con người vật trái đất mà nỗ l c d c tích c c, hai mươi...
  • 21
  • 318
  • 0
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 5 ppt

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 5 ppt

Ngày tải lên : 22/07/2014, 00:20
... phát c chất đ c c c; tay bạn, đưa nh c c c nư c, rụt lại không làm T c là, bạn biết chất đ c, c c không bị động đến c c Do đó, vi c biết trở thành hành động, gọi tri th c đắn Và bạn phải nỗ l c ... r c người lao động - tất họ c n thiết, họ c ích cho xã hội Nhưng sai lầm coi vi c giáo d c để kiếm sống giáo d c cho sống Một người kiếm c m chết Upanisad nói hai hữu d ng C hai hữu d ng theo ... th c đi, c gắng, d n d n, để theo c ch th c thầy.” Tri th c bị áp đặt để tạo hành động đó, không trở thành hành động theo c ch riêng nó, Upanishad gọi avidya - d t nát Chính vidya - tri thức...
  • 21
  • 255
  • 0
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 4 ppsx

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 4 ppsx

Ngày tải lên : 22/07/2014, 00:20
... c a tôi’, m c đích vi c gọi Đã c m c đích cho vi c nói c a tôi’ chừng c m c đích cho vi c nói c a bạn’ - c c a tôi’ Cho nên bạn tạo biên giới, bạn vẽ đường bao để giới hạn c a tôi’ Bạn ... Không, c c ch kh c để vào bên Nếu c ch th c khoa h c cách th c để vào bên điều c nghĩa khó khăn lớn Thế nhà khoa h c thắng Nhưng ông ta thắng đư c, thất bại ông ta chắn C thể c chậm trễ vi c tìm ... diện c m ghét Nếu c m ghét, tình yêu nở rộ theo c ch - tự phát, tự nhiên Không kh c cần th c cho nở rộ Điều giống vứt bỏ tảng đá chẹn d ng suối nhỏ: bỏ ra, d ng suối tuôn chảy theo c ch riêng Theo...
  • 21
  • 313
  • 0

Xem thêm