cách dùng a lot of a few
MUCH, MANY, LOT OF, A LOT OF VÀ CÁC CÁCH DÙNG ĐẶC BIỆT
Ngày tải lên :
17/10/2013, 23:15
...
Plenty of shops take checks.
A large a mount of = a great deal of + non-count noun (formal
English)
I have thrown a large amount of old clothing.
Mr Lucas has spent a great deal of time ... more of Ray and Barbara.
(Rất hay khi được gặp Ray và Barbara thường xuyên hơn.)
She has eaten most of that cake.
Most of us thought he was wrong.
Most cũng được dùng thay cho một danh từ, ... the Far East.
A lot và a great deal có thể được dùng làm phó từ và vị trí c a nó là
ở cuối câu.
On holiday we walk and swim a lot.
The gorvernment seems to change its mind a great deal....
- 8
- 6.7K
- 1.4K
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx
Ngày tải lên :
02/04/2014, 13:20
... of time.
* Plenty of shops accept credit cards.
A large amount of, a great deal of , a large number of
Cách diễn đạt này mang tính tương đối trang trọng. Sau A large amount of và a
great ...
* A lot of my friends live abroad.
* Lots of time is needed to learn a language.
Plenty of
Plenty of mang ngh a : “đủ và nhiều hơn n a , theo sau đó là danh từ không đếm
được và danh ... a lot rice left.)
* There is not much rice left. (không phải là: There is not much of rice left.)
A lot of - lots of
Không có sự khác nhau nhiều gi a a lot of và lots of. A lot of và lots...
- 6
- 1.7K
- 11
Cách sử dụng a lot of
Ngày tải lên :
16/05/2014, 22:03
... 3. A large amount of, a great deal of , a large number of
- Cách diễn đạt này mang tính tương đối trang trọng. Sau A large amount of và a great
deal of là danh từ không đếm ... dụ:
* She has spent a great deal of time in Europe.
- Sau A large number of là trước danh từ số nhiều, và động từ theo sau nó cũng chia theo
chủ ngữ số nhiều:
Ví dụ:
* A large number of issues ... theo sau nó cũng chia theo
chủ ngữ số nhiều:
Ví dụ:
* A large number of issues still need to be addressed.
...
- 2
- 618
- 0
much, many, a lot of
Ngày tải lên :
14/10/2013, 16:11
... much/ many (nhiều) và most ( a phần). A lot of/ lots of
(informal) = a great deal/ a large number of/ much/ many (formal).
• Không có khác nhau gì mấy gi a a lot of và lots of. Chủ ngữ chính sau ... (formal English)
I have thrown a large amount of old clothing.
Mr Lucas has spent a great deal of time in the Far East.
• A lot và a great deal có thể được dùng làm phó từ và vị trí c a nó ... sau hai thành ngữ này sẽ
quyết định việc chia động từ.
a lot of
lots of
| uncountable noun + singular verb
| plural noun + plural verb
A lot of time is needed to learn a language.
Lots of us...
- 4
- 808
- 6
Tài liệu Much, many, a lot of và lots of – trong một số trường hợp khác pdf
Ngày tải lên :
12/12/2013, 22:15
... biệt alot/ lots of/ plenty/ a great deal với many/ much
Các thành ngữ trên đều có ngh a tương đương với much/ many (nhiều) và most ( a phần). A lot
of/ lots of (informal) = a great deal/ a large ... plenty of time
.
Plenty of shops
take checks.
•
A large a mount of = a great deal of + non-count noun (formal English)
I have thrown a large amount of old clothing.
Mr Lucas has spent a great ... number of/ much/ many (formal).
•
Không có khác nhau gì mấy gi a a lot of và lots of. Chủ ngữ chính sau hai thành ngữ này
sẽ quyết định việc chia động từ.
a lot of
lots of
| uncountable...
- 5
- 890
- 6
Camilla: A Tale of a Violin Being the Artist Life of Camilla Urso pdf
Ngày tải lên :
07/03/2014, 01:20
... her father and met
Madam Sontag's party at Cincinnati. Aunt Caroline traveled with them as far as Louisville, Ky. Madam
Sontag, who was greatly pleased with Camilla here offered to have a motherly ... West. As mother and daughter had been separated for a long time Madam Urso traveled with
Camilla a portion of this journey. Unfortunately Madam Urso was taken sick at Cincinnati and for a while
Camilla ... truth was hidden in the master's
pleasantry. Camilla was rapidly distancing them all. She was the favorite scholar. She had the advantage of
Massart's private instruction three times a week...
- 56
- 403
- 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
Ngày tải lên :
07/03/2014, 12:20
... Comparini C, Calamassi R, Pazzagli L,
Cappugi G & Scala A (2004) Cerato-platanin protein is
located in the cell walls of ascospores, conidia and
hyphae of Ceratocystis fimbriata f. sp. Platani. ... 341–346.
25 Pazzagli L, Cappugi G, Manao G, Camici G, Santini A
& Scala A (1999) Purification, characterization, and
amino acid sequence of cerato-platanin, a new phyto-
toxic protein from Ceratocystis ... [e.g.
cerato-platanin of Ceratocystis fimbriata f. sp. platani,
Snodprot1 of Phaeosphaeria nodorum and Sp1 of
Leptosphaeria maculans) or human allergens and path-
ogenesis-related proteins (As-CG of Coccidioides...
- 14
- 494
- 0
Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf
Ngày tải lên :
15/03/2014, 23:20
... per
frame.
Native data were collected to a resolution of 1.4 A
˚
.
A total of 360 frames of data with an oscillation angle of
0.45° were collected. The exposure time was 0.5 s per
frame. All datasets ... Frederick CA, Wang AH & Rich A (1987) A
bifurcated hydrogen-bonded conformation in the
d (A. T) base pairs of the DNA dodecamer
d(CGCAAATTTGCG) and its complex with distamy-
cin. Proc Natl Acad Sci ... bond length (A
˚
) 0.017
rmsd bond angles (°) 1.61
Ramachandran plot favoured (%) 100
Ramachandran plot accepted (%) 0
Ramachandran plot outliers (%) 0
PDB code 3M8J
a
For replicate reflections,...
- 14
- 459
- 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
Ngày tải lên :
16/03/2014, 16:20
... Thermoplasma
volcanium. Proc.NatlAcad.Sci.USA97, 14257–14262.
49. Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Hai-
kawa,Y.,Jin-n.,o,K.,Takahashi,M.,Sekine,M.,Baba,S.,
Ankai, A. , Kosugi, ... horikoshii;Pa,P. abissi;Ss,S. solfataricus;St,S. tokodaii;Ap,Aeropyrum pernix;Ta,Thermoplasma acidophilum;Tv,Ther-
moplasma volcanium;Fa,Ferroplasma acidarmanus;Tm,Thermot oga mar itima;Aa,Aquifex aeolicus;Tt,Thermoanaerobacter ... K.,
Takahashi,M.,Sekine,M.,Baba,S.,Ankai ,A. ,Kosugi,H.,
Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R.,
Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka,
T., Kudoh, Y., Yamazaki, J., Kushida, N., Oguchi,...
- 12
- 506
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
Ngày tải lên :
23/03/2014, 11:20
... GGCAACGAGCAAGGTCCGAAG
sapE–R 2590 R GACGTCGTGAGTGCCTCCGTG
mopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGG
mopB–R 3103 R AGTATCAAACCGTGCTGGTCTCC
Heme protein identification in M. capsulatus O. A. Karlsen ... CCP-similar
core.
A similarity search against the translated GenBank
nucleotide database (tBLASTn) revealed significant
similarity between MCA2590 and an unannotated
ORF of Methylomicrobium album ... NY.
33 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang
Z, Miller W & Lipman DJ (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res...
- 12
- 392
- 0
Cách sử dụng (Something) is down to (a number of something) pdf
Ngày tải lên :
10/03/2014, 11:20
...
bao gạo”.
Thông thường bạn nói về số lượng sự vật/ đồ vật bị giảm, nhưng bạn cũng có thể
liệt kê như:
Now it’s down to just me, Claire, and Maria - Hiện giờ chỉ còn tôi, Claire và
Maria. ...
Công ty c a bạn v a gặp phải chút rắc rối. Phần lớn nhân viên trong bộ phận c a
bạn đều bị sa thải. Và giờ chỉ có bạn, sếp c a bạn và 1 nhân viên n a. Bạn nói
chuyện với bạn c a mình về tình ... van, so we’re down to two vehicles now - chúng tôi bán chiếc xe tải,
vì thế giờ chúng tôi chỉ còn 2 chiếc xe.
Hoặc về đồ ăn: “We’re down to half a bag of rice” = “chúng tôi giờ chỉ còn nửa...
- 6
- 702
- 2
- cách sử dụng a lot of
- cách sử dụng some any much many a lot of
- cách sử dụng a few a little a lot of
- cách sử dụng some any a lot of
- cách sử dụng của a lot of
- cách dùng a lot of a few
- cách dùng a little a few a lot of
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2