cyclic behaviour of a duplex stainless steel under multiaxial loading experiments and modelling
Báo cáo khoa học: "The humus of a "Parabraunerde" (Orthic Luvisol) under Fagus sylvatica L and Quercus robur L and its modification in 25 years" docx
... twigs and skeletal leaf pieces The leaf pieces and the Enchytraeidae and Oribatidae faecal pellets are stored in alternate layers (0.02 g/cm ) Oh (1.5-0.0) Compact fine humus and mineral particles ... plant tissue is almost com); pletely decomposed and humified; Oribatidae faeces, an increased amounts of Enchytraeidae faeces and small amounts of worm faeces are also present Ah1 (0-2.5) Loamy, ... with faeces (0.13 g/cm ) The leaf surfaces are covered with faeces OAh (0-2) twig pieces and 70% arthroand worm faeces The earth worm faeces contain ≈ 50% mineral particles 30% leaf and pod Ah1...
- 12
- 210
- 0
Báo cáo vật lý: "Effect of Temperature on Corrosion Behavior of AISI 304 Stainless Steel with Magnesium Carbonate Deposit" docx
... English of not more than 100 words Avoid abbreviations, diagrams and reference to the text Malaysian author(s) should, in addition, submit a Bahasa Malaysia abstract Articles written in Bahasa Malaysia ... very grateful to the Ministry of High Education, Malaysia for Research Grant: 9003-00144 Also thanks to Director of Department of Occupational Safety and Health Malaysia for his encouragement and ... formation of oxide layer on the metal surface, and mass of steel are changed with the increasing temperature.4–6 Figures 2 (a) , (b) and (c) show the SEM of MgCO3 coated alloy The layer of scales are...
- 8
- 512
- 0
Báo cáo y học: "Absence of a serum melatonin rhythm under acutely extended darkness in the horse" ppsx
... re-entrainment rates of plasma melatonin and core body temperature following an abrupt 6-h phase advance of the LD cycle [23] In contrast to studies that demonstrate a gradual adaptation of melatonin ... design, sample collection, data analysis and interpretation, and prepared the manuscript JAE contributed to study design, data analysis, interpretation and figure preparation, ran the MT RIA, and ... between rodents and ungulates In contrast to rodents, the nocturnal rise of melatonin arylalkylamine N-acetyltransferase (AA-NAT) in sheep is not accompanied by a similar rise in AANAT mRNA expression...
- 8
- 325
- 0
Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot
... All authors have read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of ... clear urine via Figure fat saturation and gadolinium enhancement T1-weighted coronal magnetic resonance imaging scan with T1-weighted coronal magnetic resonance imaging scan with fat saturation ... differential diagnosis was either a tumour or an abscess Given that the patient was septic, this cystic lesion with an enhancing capsule was likely to be an abscess rather than a tumour Again no...
- 3
- 306
- 0
Cyclic and post cyclic behaviour of soft clays
... instance, Zanvoral and Campanella (1994) and Thammathiwat and Weeraya (2004) found that damping in clays increases with loading frequency while Shibuya et al (1995) and Teachavorasinskun et al (2002) ... introduction of drainage can be viewed as an additional variable into the assessment of post -cyclic behaviour of clays Sangrey and France (1980) justified the use of drainage during cyclic loading by assuming ... preceding paragraphs provide a glimpse at the fundamental goal of this research: to examine the cyclic and post -cyclic response of Singapore Marine Clay and present a detailed characterization of its...
- 246
- 603
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International Medication System ... G, Markogiannakis A, Papaparaskevas J, Daikos GL, Stefanakos G, Zissis NP, Avlamis A Differences in the changes in resistance patterns to third- and fourth-generation cephalosporins and piperacillin/tazobactam...
- 6
- 692
- 0
Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx
... ratio change in favor of n-3 PUFA and particularly an n-3 DPA and EPA An increase in n-3 DPA and EPA, and perhaps other n-3 PUFAs, stimulates Jak2 and Stat5 activation, and induces b-casein expression ... differentiation effect of pregnancy Table Analyses of fatty acid ratio and relative contents of n-3 PUFAs EPA, DPA, and DHA in mammary glands Whole inguinal mammary fat pads were isolated and contents ... development and differentiation The effect of an n-6 ⁄ n-3 ratio change on mammary gland development and differentiation was assayed by morphological analyses of ductal elongation and appearance of a differentiated...
- 12
- 421
- 0
Source investigation of a small event using empirical Green’s functions and simulated annealing ppt
... active area on the fault This gives us values of the average total slip of between 0.1 and cm and a stress drop of between I and 10 bar for a rise time equal to At, and a stress drop that can reach ... iaround 0.1, and the number of iterations at a constant temperature equal to 10 This gives a good estimate of the average energy and the standard deviation Another problem that has to be solved ... scale For each of the two possible fault planes, the active fracture area has a different shape Fig shows a rupture propagation towards the north-north-east for the two fault planes The shape and...
- 13
- 486
- 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot
... providing a large amount of information about its interaction and ET properties to Fd, Fld and NADP+ [8–11] Three-dimensional structures of Anabaena wild-type (WT) FNR, several of its mutants and of ... that shows a typical absorbance band at 450 nm [33] Time-sequential spectra recorded after addition of CYP1 1A1 to an anaerobic CO-saturated sample containing the reaction mixture FNRrd/Adxox gave ... the anaerobic reaction between FNRrd and Adxox using a constant FNR concentration and increasing [Adxox]/[FNRrd] ratios (A) Time-course for the anaerobic reaction between FNRrd and Adxox as followed...
- 10
- 400
- 0
Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf
... Microarray-based detection and genotyping of viral pathogens Proc Natl Acad Sci U S A 2002, 99:15687-15692 Allander T, Andreasson K, Gupta S, Bjerkner A, Bogdanovic G, Persson MA, Dalianis T, Ramqvist ... ligase (Roche, Mannheim, Germany) The first amplification stage (20 cycles, 50 μl reaction volumes) used 300 nM of primers CTCGTAGACTGCGTACGATG and GACGATGAGTACTGATCGC at 56°C annealing temperature ... linkers for the HinP1I-site (GACGATGAGTCCTGAT and Phosphate-CGATCAGGACTCAT, 1:1) and the CviII-site (CTCGTAGACTGCGTACG and Phosphate-ATCGTACGCAGTC, 1:1) were ligated to the complete phenol-purified...
- 10
- 432
- 0
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... S Ahmad and I M Stamova, “Almost necessary and sufficient conditions for survival of species,” Nonlinear Analysis Real World Applications, vol 5, no 1, pp 219–229, 2004 10 Y.-H Fan and L.-L Wang, ... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, “On the nonautonomous Volterra-Lotka...
- 9
- 351
- 0
báo cáo hóa học:" Research Article The Permanence and Extinction of a Discrete Predator-Prey System with Time Delay and Feedback Controls" ppt
... response,” Journal of Mathematical Analysis and Applications, vol 281, no 1, pp 395–401, 2003 T K Kar and U K Pahari, Modelling and analysis of a prey-predator system with stage-structure and harvesting,” ... response,” Journal of Mathematical Analysis and Applications, vol 317, no 2, pp 464–474, 2006 D T Dimitrov and H V Kojouharov, “Complete mathematical analysis of predator-prey models with linear prey ... Journal of Mathematical Analysis and Applications, vol 257, no 1, pp 206–222, 2001 N P Cosner, D L deAngelis, J S Ault, and D B Olson, “Effects of spatial grouping on the functional response of predators,”...
- 20
- 442
- 0
báo cáo hóa học:" Research Article Dynamical Analysis of a Delayed Predator-Prey System with Birth Pulse and Impulsive Harvesting at Different Moments" pdf
... Pitman Monographs and Surveys in Pure and Applied Mathematics, Longman Scientific & Technical, Harlow, UK, 1993 J Jiao, X Yang, S Cai, and L Chen, “Dynamical analysis of a delayed predator-prey model ... time to maturity w is the natural death rate of the immature prey population d1 is the natural death rate of the mature prey population d2 is the natural death rate of the predator population The ... incidence rate,” Applied Mathematical Modelling, vol 33, no 1, pp 555–563, 2009 J Jiao and L Chen, “Global attractivity of a stage-structure variable coefficients predator-prey system with time delay and...
- 15
- 289
- 0
báo cáo hóa học:" Dynamical analysis of a biological resource management model with impulsive releasing and harvesting" pdf
... Dynamical analysis of a biological resource management model with impulsive releasing and harvesting Jianjun Jiao∗1 , Lansun Chen2 and Shaohong Cai1 School of Mathematics and Statistics, ... per-capita rate of predation of the predator, d > is the death rate of predator, c > denotes the product of the per-capita rate of predation and the rate of conversing prey into predator If rc < ad ... Statistics, Guizhou Key Laboratory of Economic System Simulation, Guizhou University of Finance and Economics, 550004 Guiyang, P R China Institute of Mathematics, Academy of Mathematics and System Sciences,...
- 31
- 284
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
... temperature and transpi- a crown ration rate; the resistance and capacitance of each compartment are independent of the flux or water potential of the compartment and remain constant during the day ... stand using optically determined leaf area index values (table I), assuming the needles had a semi-cylindrical shape, and calculating the sap flux as the average of the measurements made at a ... on accurate determinations of the tree sap flow, which requires determination of sapwood area, mean sapflux density and needle area in a stand to a high degree of accuracy Thus, application of...
- 18
- 406
- 0
Báo cáo y học: "Demonstration of a novel technique to quantitatively assess inflammatory mediators and cells in rat knee joints" pps
... Luminex assay 2.4 Data Analysis Data were collected and analysed using Microsoft Excel and Graphpad Prism software Results are expressed as mean ± standard error of the mean (SEM) where appropriate ... between each anaesthetic and basal levels Pentobarbital anaesthesia resulted in a significant elevation of GM-CSF and TNFα levels; statistical significance P < 0.05 indicated by * Page of (page number ... and reviewed and edited the article IPC, AJR and DSM contributed intellectually to the experimental designs, as well as to structural and editorial aspects of the paper All authors read and approved...
- 8
- 403
- 0
Báo cáo y học: " Osteolytic bone destruction resulting from relapse of a testicular tumour 23 years after inguinal orchiectomy and adjuvant chemotherapy: a case report" pot
... 5th and 10th year after primary treatment with a calculated annual risk of 1% In two patients, late relapse occurred later than 10 years One of these patients presented with metastatic seminoma, ... 1984, the patient’s histopathology revealed a mixed tumour, a choriocarcinoma and an embryonic carcinoma, with retroperitoneal and pulmonary metastases To treat this, an orchiectomy was performed, ... chemotherapy; and 3) the development of a secondary germ cell carcinoma and the microscopic persistence of tumour cells with atypical biological behaviour [8] Albers et al wrote the European Association...
- 4
- 294
- 0
Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf
... no professional input They can be used as stand-alone interventions or as an adjunct to other forms of intervention This is a rapidly growing area and a recent meta-analysis of studies evaluating ... relapse and hospitalisation rates [4,5] FIs generally focus on cognitive and behavioural techniques to modify appraisals that relatives hold about the behaviour of the person with psychosis and ... Categorisation and thematic analysis of the data will be developed by cycling between the analysis and transcripts and periodic ‘testing’ of the analysis by discussion amongst the entire team...
- 7
- 305
- 0
Báo cáo khoa học: " Effect of a povidone-iodine intrauterine infusion on progesterone levels and endometrial steroid receptor expression in mares" pptx
... nonseasonal endometrial hypoplasia, and lymphatic lacunae were evaluated Page of Statistical analysis All variables were subjected to analysis of variance using a mixed model (Statistical Analysis ... The number (average in linear fields of 5.5 mm) and pattern of distribution of fibrotic nests were evaluated, as well as any associated glandular atrophy and/ or cystic glandular change Also hypertrophy, ... the luminal and glandular epithelium [9], in addition to the Kalpokas et al Acta Veterinaria Scandinavica 2010, 52:66 http://www.actavetscand.com/content/52/1/66 formation of functional glands Endometrial...
- 8
- 347
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25