0

cultivate meet 140 characters each with a unique story

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học

... CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA GCTAGGATCCCTAGCAACCACGGCAC Table Antifungal activity ... Escherichia coli and assays of recombinant WAMP 1a activity against diverse plant pathogens, such as chitin-containing and chitin-free fungi, and Grampositive and Gram-negative bacteria The amino acid ... activity of peptides was assayed against several Gram-positive and Gram-negative bacteria using radial diffusion assay Petri dishes with Luria–Bertani agar were seeded with test bacteria The peptide...
  • 10
  • 505
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Orlicz Sequence Spaces with a Unique Spreading Model" pdf

Hóa học - Dầu khí

... University, Tianjin, China, 2007 G Androulakis, E Odell, Th Schlumprecht, and N Tomczak-Jaegermann, “On the structure of the spreading models of a Banach space,” Canadian Journal of Mathematics, vol 57, ... Odell, and B Sari, “Lattice structures and spreading models,” Israel Journal of Mathematics, vol 161, pp 387–411, 2007 A Brunel and L Sucheston, “On B-convex Banach spaces,” Mathematical Systems ... SPw hM and CM,1 coincide That is, SPw hM Journal of Inequalities and Applications Orlicz Sequence Spaces with Equivalent Spreading Models Definition 3.1 see Let xn be a normalized Schauder basis...
  • 10
  • 216
  • 0
140 CHARACTERS A Style Guide for the Short Form

140 CHARACTERS A Style Guide for the Short Form

Internet Marketing

... Commas are a favor to the reader, not always necessary Eliminate personal pronouns When all else fails, invent a tag .A great tag works as the target of a search, and also declares its place within ... 108 109 Chapter 12 Cultivate: Meet 140 Characters, Each with a Unique Story Create a Culture of Fun Imagine Your Audience Focus on Learning 110 110 112 113 Chapter 13 Branch: Steady, Organic Growth ... there was a certain feature vacuum and innovation took a backseat to maintenance In mid-2008, as Twitter began to grow exponentially, a service called Summize was launched, with Twitter as its...
  • 210
  • 3,112
  • 0
Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt

Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt

Báo cáo khoa học

... The unusual Thermosynechoccus elongatus DpsA F Alaleona et al UV and gamma irradiation, and acid and base shock [3] Furthermore, it was established that the DNAbinding capacity is shared only ... the alternative sigma factor sigmaB in Bacillus subtilis J Bacteriol 179, 7251–7256 Nakamura Y, Kaneko T, Sato S, Ikeuchi M, Katoh H, Sasamoto S, Watanabe A, Iriguchi M, Kawashima K, Kimura T ... (on a dodecamer basis) of 2.03 · 105 m)1Æcm)1, calculated with protparam (http://www.expasy.org) Removal of the His-tag A factor Xa cleavage site was created between the last amino acid (valine)...
  • 15
  • 293
  • 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Báo cáo khoa học

... was amplified by PCR from the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5¢-CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢-GGATCCTCGAG CTCATTTACGTTTTAAATTAATGCCGAT-3¢ ... c-glutamyltranspeptidase from Escherichia coli, a key enzyme in glutathione metabolism, and its reaction intermediate Proc Natl Acad Sci USA 103, 6471–6476 Boanca G, Sand A, Okada T, Suzuki H, Kumagai H, Fukuyama ... One glutamate was bound to each of the deeply grooved catalytic pockets in the asymmetric unit, and the glutamate-binding modes are identical to each other (Fig 2A) The a- carboxyl and a- amino groups...
  • 10
  • 375
  • 0
Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

Báo cáo khoa học

... reversetranscribed and PCR-amplified using proofreading DNA polymerase (Invitrogen), forward primer 5¢-TTCCTGC AGTGGAAACCGGCAGTGAGGCCA-3¢ and reverse Structure of deer haptoglobin primer 5¢-CGGAAAACCATCGCTAACAACTAAGCTT ... compared with other mammals [31,32] This model appears to be consistent with the overall amino acid alterations (32%) within the tandem repeat of deer Hp a- chain A similar alteration in cattle has also ... of tandem repeat region (B and B1) of deer and human a- chain The most significant feature of human a2 is that it matches the ABC domains of a1 but with an additional insertion of a redundant sequence...
  • 13
  • 527
  • 0
Báo cáo y học:

Báo cáo y học: "Biology of recently discovered cytokines: Interleukin-17 – a unique inflammatory cytokine with roles in bone biology and arthrits" pdf

Báo cáo khoa học

... 11:2044-2055 Takaya H, Andoh A, Makino J, Shimada M, Tasaki K, Araki Y, Bamba S, Hata K, Fujiyama Y, Bamba T: Interleukin-17 stimulates chemokine (interleukin-8 and monocyte chemoattractant protein-1) ... nuclear factor-kappaB and receptor activator of nuclear factor kappaB (RANK)/RANK ligand signaling? Bone 2001, 28:378-386 33 Witowski J, Pawlaczyk K, Breborowicz A, Scheuren A, KuzlanPawlaczyk ... osteoprotegerin ligand Nature 1999, 402:304-309 Nakashima T, Kobayashi Y, Yamasaki S, Kawakami A, Eguchi K, Sasaki H, Sakai H: Protein expression and functional difference of membrane-bound and soluble...
  • 8
  • 384
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Primary appendiceal mucinous adenocarcinoma alongside with situs inversus totalis: a unique clinical case" pps

Báo cáo khoa học

... Surgery, Athens Medical School, LAIKON GENERAL HOSPITAL, with a left lower quadrant abdominal pain, that arisen 24 h ago in the umbilical area, accompanied with low fever, as well as anorexia and ... nonmetastatic adenocarcinoma of the appendix Though mucinous' adenocarcinoma spread to adjacent organs is detectable at presentation in a percentage 63%, the approximate overall 5-year survival rate ... Leucovorin, Oxaliplatin and Irinotecan [9] Avastin, a monoclonal antibody displaying an antiangiogenic action, as well as bevacizumab are also sometimes added [19-21] The location of the appendix...
  • 5
  • 292
  • 0
báo cáo khoa học:

báo cáo khoa học: "Uneventful octreotide LAR therapy throughout three pregnancies, with favorable delivery and anthropometric measures for each newborn: a case report" doc

Báo cáo khoa học

... mediastinum Treatment with steroid synthesis blockers was initiated Mediastinal and paratracheal histopathology of lymph node material obtained by performing a thoracoscopy showed a metastatic carcinoid ... Rappaport Faculty of Medicine, Technion, Haifa, Israel Department of Pathology, G Gennimatas Athens General Hospital, Athens, Greece 3Department of Medicine, E Rambam Health Campus and Rappaport ... 25-year-old Arabic woman presented to the emergency department of our medical facility with rapid onset of headache, flaring acne and hirsutism, facial puffiness, weight gain and paroxysmal myopathy,...
  • 5
  • 348
  • 0
Drawing - Fun With A Pencil

Drawing - Fun With A Pencil

Mỹ thuật

... can trace a photo, and draw from the tracing, or take any of your own drawings and distort them Here again is a chance for your own invention Draw a square around your subject Divide each way ... Nevertheless, we can take as a basic form a ball sliced off at the sides, leaving it a little wider one way than the other, and adding to it or taking some away The forehead may be flattened, cut ... make any allowance for the variety of shapes 36 After this book was published, I learned with interest that a similar basic head form has been used for years by Miss E Grace Hanks of the Pratt...
  • 123
  • 1,965
  • 6
Báo cáo y học:

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Y học thưởng thức

... investigated, and the operation will be planned with as little trauma as possible, in order to preserve the hard and soft surrounding structures Clinical case A 30 years old Caucasian patient came ... patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without functional limitations or fever No occlusal hindrance was caused by these supernumerary teeth Although ... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic...
  • 7
  • 597
  • 0
Báo cáo y học:

Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"

Y học thưởng thức

... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... C-fibres Acta Anaesthesiol Scand 1990; 34: 335-8 69 Pasqualucci A, Varrassi G, Braschi A, et al Epidural local anesthetic plus corticosteroid for the treatment of cervical brachial radicular pain: ... 20: 539-45 Schwarzer AC, Wang SC, Bogduk N, et al Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Australian population with chronic low back pain Ann Rheum Dis...
  • 12
  • 669
  • 0
Báo cáo y học:

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Y học thưởng thức

... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis...
  • 8
  • 499
  • 0
What To Do If Trapped In A Lift With A Dentist

What To Do If Trapped In A Lift With A Dentist

Tài liệu khác

... others history is a corpse leave it alone it teaches us nothing except how to repeat past mistakes again and again and again WAR War what is it good for? Reinvigorating depressed economies and winning ... relaxation CD that appears to be voiced by Ian Paisley A pair of trainers pickled in bree A vague sense of inadequacy A perambulating hamster nailed to the knee of a disgruntled member of a select ... it? What have you done today with your higher consciousness? Watched the telly? Had an argument? Made a sandwich? Started a war? If we're a species apart then why we behave like animals? Because...
  • 34
  • 515
  • 0
Propelling Business Growth With A Secure And Continuous Information Infrastructure

Propelling Business Growth With A Secure And Continuous Information Infrastructure

Công nghệ thông tin

... from tape and validated  Application: restored from tape and validated  Data: restored from tape and validated  Connectivity: restored and validated  Redundancy of data: recover lost transaction ... transaction and validate  Redundant site: ready (warm site)  Recovery plans: ready  OS: restored from tape and validated  Application: restored from tape and validated  Data: restored from tape and ... up to (+/-) days +/- 24 hours up to (+/-) days  Sync = data loss  Async = acceptable data loss *(Potential for data loss for Async)  Sync = data loss  Async = acceptable data loss Recovery...
  • 27
  • 346
  • 0
Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP

Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP

Môi trường

... conventional parameter apparatus such as temperature, pH and conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, ... instruments in Qinghe WWTP Locatio Apparatus for Apparatus for water quality analysis n* conventional parameters Flowmeter/ Liquid Multi-function water quality analysis apparatus (for pH, T, level BOD5, ... WWTPs have their own data management systems, such as SCADA (Supervisor, Control and Data Acquisition) and control system with the function to pick up the analysis data and control the automatic...
  • 9
  • 675
  • 0
A kinetic study of resorcinol-enhanced hydroxyl radical generation during ozonation with a power law type equation

A kinetic study of resorcinol-enhanced hydroxyl radical generation during ozonation with a power law type equation

Môi trường

... that combined a rapid data acquisition system with an ESR spectrometer (RE-1X, JEOL, Tokyo, Japan) and a stopped-flow system (Ohtsuka Electric Co Ltd., Osaka, Japan) The OH radicals trapped with ... radical generation 1.5-fold that of phenol itself Power law type rate equations are usually adopted to correlate the experimental data in laboratory-scale and pilot-plant scale reactors, and even ... REFERENCES Andreozzi R., Caprio V., Insola A and Marotta R (1999) Advanced oxidation processes (AOP) for water purification and recovery Catal Today, 52, 51-59 Bader H and Hoigne J (1981) Determination...
  • 7
  • 569
  • 0
Reporting with a Windows Service

Reporting with a Windows Service

Kỹ thuật lập trình

... adding the dataset or data table, please refer to Chapter for a walkthrough Step 2: Designing the Report Layout All right, we have our dataset in place with its data table and all the necessary columns ... Value Complaint Type ComplaintID Value =Fields!ComplaintID.Value CreateDate Value =Fields!CreateDate.Value CreateDate Format d CreateDate TextAlign Left CustomerName Value =Fields!CustomerName.Value ... selecting Add ® DataTable Click the header of the newly created data table, and name it dtComplaintList Start adding columns to dtComplaintList by right-clicking the data table and selecting Add ®...
  • 24
  • 378
  • 1

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25