ct of tumor in head of pancreas variations in common bile and pancreatic ducts
Báo cáo khoa học: Characterization of sequence variations in human histone H1.2 and H1.4 subtypes pptx
Ngày tải lên :
30/03/2014, 20:20
... variants in human cell lines Fig DNA sequencing of H1.2 PCR products Fig DNA sequencing of H1.4 PCR products A B C Fig Restriction fragment length polymorphism (RFLP) analysis of H1.2 PCR products ... On binding to DNA, the C-terminal tail probably adopts the structure of a segmented a helix [40] Replacement of lysine with arginine may affect the secondary structure of the C-terminal tail and ... potential utility of HILIC as a means of investigating the occurrence of sequence variations within linker histone subtypes from various human tumor cell lines By using HILIC we detected amino acid substitutions...
- 11
- 442
- 0
báo cáo hóa học: " Nonlocal conditions for differential inclusions in the space of functions of bounded variations" ppt
Ngày tải lên :
21/06/2014, 02:20
... u.s.c and ( ) is compact By the Theorem of Bohnenblust and Karlin (see Corollary 11.3 in [8]) has a fixed point in Σ, which is a solution of the inclusion (2), and therefore a solution of (1) ... Agarwal and Boucherif Advances in Difference Equations 2011, 2011:17 http://www.advancesindifferenceequations.com/content/2011/1/17 Page of 10 Main results In this section we state and prove our main ... Definition The multifunction F : I X ® X is of bounded variation if for any function × Î BV(I, X) the multivalued map NF(x): I ® X is of bounded variation on I (in the sense of Definition 2) and...
- 10
- 369
- 0
Báo cáo hóa học: " Research Article Towards Structural Analysis of Audio Recordings in the Presence of Musical Variations" docx
Ngày tải lên :
22/06/2014, 23:20
... of the data stream by modifying the values of w and q For example, using a window size of w = 53 (instead of 41) and a downsampling factor of q = 13 (instead of 10) simulates a tempo change of ... a link of minimal cost, referred to as initial link, and construct a path in a greedy fashion by iteratively adding links of low cost, referred to as admissible links In step (2), all links in ... corresponding feature resolution of Hz; see Section In the path extraction algorithm of Section 4, we set Cin = 0.08, Cad = 0.16, Cpr = 0.10, and K0 = Finally, in the clustering algorithm of Section...
- 18
- 311
- 0
Báo cáo khoa học: "Malignant mixed tumor in the salivary gland of a cat" potx
Ngày tải lên :
07/08/2014, 20:24
... cases of true malignant mixed tumors of the salivary gland in humans, the most common epithelial-origin tumor was squamous cell carcinoma or adenocarcinoma, whereas the most common nonepithelial tumor ... mixed tumors, carcinomas and sarcomas have been observed in veterinary cases of pleomorphic Malignant mixed tumor in the salivary gland of a cat 333 adenoma, and several case reports describing ... Pathology of the Head and Neck pp 623-627, Churchill Livingstone, New York, 1988 Galli J, Parrilla C, Corina L, Ricci R, Paludetti G Carcinosarcoma of the submandibular salivary gland: clinical case and...
- 3
- 302
- 0
Báo cáo y học: " Imbalance of local bone metabolism in inflammatory arthritis and its reversal upon tumor necrosis factor blockade: direct analysis of bone turnover in murine arthritis" ppsx
Ngày tải lên :
09/08/2014, 07:20
... effects on bone make TNF an ideal candidate for linking inflammation and bone loss Indeed, the therapeutic blockade of TNF is highly effective in preventing and/ or reducing skeletal damage in ... Chronic inflammation can lead to sustained alterations of bone turnover, as typically seen in juxta-articular and periarticular damage of inflamed joints in RA TNF is a proinflammatory cytokine of ... phosphatase-osteocalcin double labeling Double labeling of osteoclasts and osteoblasts was performed by combining tartrate-resistant acidic phosphatase (TRAP) labeling for detection of osteoclasts and osteocalcin...
- 11
- 417
- 0
Báo cáo y học: "Serum levels of biomarkers of bone and cartilage destruction and new bone formation in different cohorts of patients with axial spondyloarthritis with and without tumor necrosis factor-alpha blocker treatment" ppt
Ngày tải lên :
09/08/2014, 13:22
... proteins and is involved in disruptive events in the cartilage and bone of inflamed joints [15] Recent publications suggest that it is closely related to inflammation and high disease activity in ... vasoenCorrelation of differences in serum levels at baseline and year of (a) metalloproteinase-3 (d_MMP-3) and C-reactived_MMP-3 and d_BALP (a) metalloproteinase-3 (d_MMP-3) and C-reactive protein (d_CRP), ... The analysis of serum biomarkers reflecting inflammation, bone destruction, and new bone formation could be helpful for a better understanding of the sequence of events in the spine Therefore,...
- 8
- 373
- 0
Genetic polymorphisms of matrix metalloproteinases and their inhibitors in potentially malignant and malignant lesions of the head and neck potx
Ngày tải lên :
10/08/2014, 05:21
... Gelatinase-B 20q11.2-q13.1 vitronectin,decorin,plasminogen Gelatin,CollagenI,IV,V,VII,X,XI,XVII I,vitronectin,Elastin,laminin,fibro nectin, ProMMP-9 proMMP-2 MMP-3 Stromelysins-1 11q22.2-22.3 Laminin, ... Elastin, gelatin, collagen I,IV, fibronectin, laminin, vitronectin, proteoglycan MMP-7 Matrilysin-1 11q22.2-22.3 Collagen I,IV,V,IX,X,XI,XVIII, Fibronectin,laminin,gelatin,aggr egan,,gelatin,proMMP-9 ... Laminin, aggregan gelatin, fibronectin MMP-10 Stromelysins-2 11q22.2-22.3 CollagenI,III,IV,gelatin,elastin,pro MMP-1,8,10 MMP-11 Stromelysins-3 22q11.2 Fibronectin,laminin,aggregan,gel atin MMP-12...
- 13
- 337
- 0
Báo cáo y học: "Variations in brachial plexus and the relationship of median nerve with the axillary artery: a case report." pps
Ngày tải lên :
10/08/2014, 10:20
... functioning of the limb of the individual, it is important to keep these in mind in surgical and anaesthesiological procedures References 10 11 12 13 Williams PL, Bannister LH, Berry MM, Collins ... medial and lateral pectoral nerves A case has been described wherein the medial pectoral nerve was a direct branch of the anterior division of the middle trunk [10] We have not found findings similar ... the C5, C6 and C7 [1] Horwartz and Tocantins have found that in 8% of the cases, C7 may fail to contribute and some times failure from contributions from C5 have been observed in dissecting laboratories...
- 5
- 365
- 0
báo cáo khoa học: " Expression of Ets-1, Ang-2 and maspin in ovarian cancer and their role in tumor angiogenesis" pps
Ngày tải lên :
10/08/2014, 10:21
... underlying the localization of maspin and its interaction with Ets-1 warrant further investigations In this study we employed IHC to evaluate the expression of Ets-1, Ang-2 and maspin in clinical ... roles in angiogenesis: Ang-1 and Ang-4 are agonist ligands for Tie2 and induce tyrosin phosphorylation of Tie2, while Ang-2 and Ang-3 are antagonist ligands They bind to Tie2 without inducing tyrosin ... grants of Science and Technology Key Projects of Heilongjiang Province, China (No C9B07C32303) and Harbin technological innovation of special funds (No 2007RFQXS091) We thank Prof Liu from Harbin...
- 6
- 230
- 0
Báo cáo y học: "Occult gallbladder carcinoma presenting as a primary ovarian tumor in two women: two case reports and a review of the literature" pot
Ngày tải lên :
11/08/2014, 12:20
... pools of mucin infiltrating and dissecting the native tissue The tumor cells were found to be floating within the mucin and many of them had a signet ring appearance Case Clinical findings A ... Northern part of India presented with complaints of pain and swelling in the abdomen and generalized weakness for a duration of four months Routine biochemistry including liver function tests and hematological ... areas The initial sections suggested possibility of a benign mucinous tumor However, presence of focal atypia in the lining epithelium and a high index of suspicion, in view of presence of a gallbladder...
- 7
- 352
- 0
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx
Ngày tải lên :
12/08/2014, 18:22
... prognosis in canine mammary tumors [5,6], and immunohistochemical detection of Bcl2, p53 and cytokeratins, in human and canine tumors and corresponding adjacent tissues, have been similar [8] In dogs, ... separation of tumors according to response to treatment (Figure 2) TGCTTTCGGAGCGTATATC CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG ... Acta Veterinaria Scandinavica 2008, 50:27 Introduction Human and canine malignant mammary tumors share some epidemiological and clinicopathological features Incidence in both species increases...
- 9
- 337
- 0
Báo cáo y học: "Variations in autologous neutralization and CD4 dependence of b12 resistant HIV-1 clade C env clones obtained at different time points from antiretroviral naïve Indian patients with recent infection" doc
Ngày tải lên :
13/08/2014, 01:20
... carrying distinct patient Envs were used to infect HeLa cells (RC49 cell line) and the infectivity expressed as percentage infection of these pseudoviruses that infected HeLa cells expressing ... 5’-TATCGGTACCAGTCTTGAGACGCTGCTCCTACTC-3’ as reverse primer in the second round by using Platinum Taq proof reading polymerase (Invitrogen Inc.) Plasma viral RNA was purified by using a nucleic ... nested PCR using 5’TAGAGCCCTGGAAGCATCCAGGAAG-3’ as forward and 5’-TTGCTACTTGTGATTGCTCCATGT-3’ as reverse primer in the first round and 5’-CACCGGCTTAGGCATCTCCTATGGCAGGAAGAA-3’ as forward and 5’-TATCGGTACCAGTCTTGAGACGCTGCTCCTACTC-3’...
- 15
- 332
- 0
Báo cáo y học: " Influence of genetic variations in TLR4 and TIRAP/Mal on the course of sepsis and pneumonia and cytokine release: an observational study in three cohorts" pdf
Ngày tải lên :
13/08/2014, 20:22
... risk of severe infections and a combination of genetic variants in sequential molecules of the LPS-sensor consisting of TLR4 and its adaptor TIRAP/Mal The presence of TLR4 mutations in combination ... infection has to be mounted early and effectively, genetic influence on cytokine response in infection may determine effectiveness of bacterial killing [28] Supporting our results, it has been recently ... shown in Table (OR 5.5; 95% CI: 1.34 to 22.64; P = 0.02) This effect was not influenced by the type of infection in these two genotype groups However, an influence of infection type was observed in...
- 11
- 429
- 0
Investigation and characterization of splice variations of l type ca2+ channel, cav 1 3, in chick basilar papilla and rat cochlea hair cells iimplications in hearing
Ngày tải lên :
14/09/2015, 18:17
... dependence of inactivation 1.4 The organ of Corti Sensing of sound from the surrounding environment and relaying the signal to the brain occurs mainly in the inner ear known as the cochlea (Latin for ... S6) linked by variable cytoplasmic loops and cytoplasmic domains of amino (N) and carboxy (C) termini (Figure 1.1) The subunit forms the ion-conducting pore and determines the main characteristics ... of calciumdependent inactivation (CDI) independent of co-expressed b-subunits in HEK293 cells using whole-cell patch recordings Steady-state inactivation (SSI) properties, mainly reflective of...
- 132
- 189
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
Ngày tải lên :
25/10/2012, 10:06
... questions worth investigating include: • What is the incidence and prevalence of musculoskeletal chest pain in chiropractic clinical practice? • What is the incidence and prevalence of musculoskeletal ... does indicate a growing level of interest in this kind of training, and will produce chiropractic physicians even better able to correctly differentiate a diagnosis of musculoskeletal chest pain ... uncertainty and complexity of chest pain diagnosis and the sometimes dynamic interplay between 'diagnosis' and 'treatment' whether in managing a given patient in actual practice or in attempting...
- 10
- 788
- 0
Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"
Ngày tải lên :
25/10/2012, 10:31
... at inception (within the first day of ICU admission) was assessed using the APACHE II score and intensity of care using the TISS score [15,16] Patients were classified into three categories of ... hypernatraemia selected to describe the incidence of sodium disturbances Baseline renal dysfunction was defined as a creatinine level greater than 100 μmol/L during the first day of ICU admission ... Hypernatremic dehydration in nursing home patients: an indicator of neglect J Am Geriatr Soc 1983, 31:466-471 Mahowald JM, Himmelstein DU: Hypernatremia in the elderly: relation to infection and mortality...
- 8
- 721
- 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
Ngày tải lên :
25/10/2012, 11:00
... Neuroimaging of the twins (a) Cerebral CT of twin A shows a vast lesion of cerebrospinal fluid intensity in the left temporal lobe with a maximum diameter of 63×40×26 mm (b) & (c) MRI of twin A shows ... an AC in the other twin (twin B), when the concerned parents took him to our department Brain CT and MRI of twin B who did not have any com- 403 plaints revealed a mirror-imaging of the AC in the ... case of MZ with mirror-imaging of AC in the literature In this case, we describe the second case of MZ with mirror-imaging of AC and discuss the possible clinical implications First, Helland and...
- 4
- 652
- 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"
Ngày tải lên :
25/10/2012, 11:35
... Prevalence of OAB, LUTS and OAB subtypes DISCUSSION The prevalence of OAB in men has been reported to be 10.2-16.0% It is expected to be much higher in the urologic setting since urinary complaint is ... detection and treat- 393 ment initiation The OAB-V8 questionnaire is a possible effective and fast screening tool Our study also examined the risk factors for OAB in men We found that OAB increased ... conflict of interest exists References Temml C, Heidler S, Ponholzer A and Madersbacher S Prevalence of the overactive bladder syndrom by applying the International Continence Society Definition...
- 4
- 520
- 0
Báo cáo y học: "Antiviral therapy of HCV in the cirrhotic and transplant candidate"
Ngày tải lên :
31/10/2012, 17:11
... more aggressive dosing of interferon and ribavirin [13, 14] Finally, growing experience with antiviral therapy in this high-risk group has led to novel approaches and increasing success Table ... reported, including two serious infections, one of which led to multi-organ system Int J Med Sci 2006, failure and death Enrollment was discontinued well short of intentions because of these complications ... unmodified interferon or peginterferon at low initial dose, with increases every two weeks toward standard target doses Duration of therapy was intended to be 24 weeks in genotypes and and 48 weeks in...
- 4
- 460
- 0