creating statistics on a subset of rows
Tài liệu CHEAP POSTAGE REMARKS AND STATISTICS ON THE SUBJECT OF CHEAP POSTAGE AND POSTAL REFORM IN GREAT BRITAIN AND THE UNITED STATES ppt
... “At a meeting of the Board of Directors of the CHEAP POSTAGE ASSOCIATION, on the 31st of March, 1848, Dr Howe, Dr Webb, and Mr Leavitt were appointed a Committee of Publication And on motion of ... head, the report of the Parliamentary Committee contains a vast mass of information, which made a deep and conclusive impression, upon the statesmen of that country They found and declared that, ... should be an equitable apportionment of this advantage, a part to go to the carrier for his additional trouble and fair profits, and a part to go towards reducing the general rate of charge If,...
- 118
- 660
- 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
... under a linear gradient of NaCl from to m gave a pure tRNAArg transcript, which was precipitated by addition of ethanol Aminoacylation reaction The aminoacylation reaction of tRNA was measured at ... no means in a conformation that is fit to activate The fact that kcat and Km for tRNAArg in the aminoacylation reaction not change in the Asn106 fi Ala, Gln111 fi Ala and Phe109 fi Ala mutants of S ... form aminoacyl-tRNA In the aminoacylation reaction of class I aaRSs with aminoacyl-AMP, the 2¢-OH group of the ribose of A7 6 tRNA attacks the carbonyl carbon atom of the –Ca–(CO)–O– moiety of aminoacyl-AMP...
- 17
- 512
- 0
Đề tài " On a class of type II1 factors with Betti numbers invariants " pdf
... Section we define the class HT of factors M having HT Cartan subalgebras A ⊂ M , i.e., maximal abelian ∗ -subalgebras A ⊂ M such that M has the property H relative to A and A contains a subalgebra ... always a 2-cocycle, ∀R), there exists a type II1 factor with a Cartan subalgebra (A ⊂ M ) associated with it, via a groupmeasure space construction “` la” Murray-von Neumann The association a (A ... inclusions and use [PoSh] to show that if a type II1 factor M has the property H relative to a maximal abelian subalgebra A ⊂ M then A is a Cartan subalgebra of M In Section we define a notion of...
- 92
- 436
- 0
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx
... inhibition of general translation with the concomitant promotion of the translation of specific mRNAs This is well illustrated by the increased translation of the activating transcription factor (ATF4), ... exchange on eukaryotic initiation factor Nature 296, 93–95 Sudhakar A, Krishnamoorthy T, Jain A, Chatterjee U, Hasnain SE, Kaufman RJ & Ramaiah KV (1999) Serine 48 in initiation factor alpha (eIF2 ... phosphorylation in conditions activating GCN2 As expected, amino acid starvation (deprivation of four amino acids) in HeLa cells resulted in increased eIF2aSer51 phosphorylation (Fig 3A, lanes 1–3 and...
- 11
- 376
- 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx
... c-secretase activity in the megaDalton range and suggest that only a subset of PS-containing c-secretase complexes are enzymatically active Gamma-secretase activity from guinea pig brain membrane ... attempts and the addition of exogenous phospholipids Calculations allowing for a 50% theoretical loss during chromatography, and the fact that only an aliquot of each fraction was assayed still placed ... that a separation between c-3FLAG standard and e-CTF-3FLAG was achieved in lane An uncharacterized anti-FLAG immunoreactive protein migrating between the a and c peptides was detected on long...
- 14
- 420
- 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG Table Plasmids used in this study Plasmid Description Source YCplac111 pGEX5X-1 ... Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPase SKD1 ⁄ VPS4 impairs membrane trafficking out of endosomal ⁄...
- 14
- 362
- 0
Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx
... excitons, phonons, etc.) in nanocone is a special case, since diameter of nanocone is a monotonous function of height, leading to gradual change of bandgap Graded bandgap structure has an effect on ... formation of nanocones on the irradiated surface of a semiconductor by selective laser heating of the top layer with following mechanical plastic deformation of the layer as a result of relaxation of ... of particles and quasi-particles, such as mobility and intrinsic concentration of electrons and holes, energy of excitons, phonons, and plasmons Therefore, study of nanocones’ formation mechanism...
- 6
- 489
- 0
Báo cáo hóa học: " On a class of second-order nonlinear difference equation" potx
... ¯ nontrivial If the solution is a nontrivial solution, then we can further divide the solution into two cases: non-oscillatory solution and oscillatory solution A nontrivial solution {xn }∞ of ... Republic of China 2School of Mathematics and Physics, University of South China, Hengyang, Hunan 421001, People’s Republic of China Authors’ contributions All authors carried out the proof All authors ... Chapman and Hall/CRC, London (2002) xn−1 Amleh, AM, Georgia, DA, Grove, EA, Ladas, G: On the recursive sequence xn+1 = α + x J Math Anal Appl 233, n 790–798 (1999) doi:10.1006/jmaa.1999.6346 Agarwal,...
- 9
- 562
- 0
Báo cáo hóa học: " Letter to the Editor Remarks on “On a Converse of Jensen’s Discrete Inequality” of S. Simic ´" doc
... → A1 A af bg aA f bA g A2 if f ∈ L, f t ≥ for all t ∈ E, then A f ≥ positivity If in addition A 1 is satisfied, then we say that A is a positive normalized linear functional Peˇ ari´ and Beesack ... increasing function of M and a decreasing function of m Remark Analogous discrete version of Theorem can be found in pages 9-10 5, Theorem 8, Journal of Inequalities and Applications Remark The ... Peˇ ari´ , F Proschan, and Y L Tong, Convex Functions, Partial Orderings, and Statistical Applications, c c vol 187 of Mathematics in Science and Engineering, Academic Press, Boston, Mass, USA,...
- 4
- 265
- 0
Báo cáo hóa học: " Research Article On a Converse of Jensen’s Discrete Inequality" doc
... equal to Er,2r Example 4.1 Taking f x 1/x, after an easy calculation it follows that S1/x a, b G a, b Therefore we consequently obtain the result A a, b / Journal of Inequalities and Applications ... 2 Journal of Inequalities and Applications with Tf a, b : max pf a − p f b − f pa p 1−p b 1.3 Note that, for a strictly positive convex function f, Jensen’s inequality can also be stated in ... aus der Analysis, Springer, Berlin, Germany, 1964 K B Stolarsky, “Generalizations of the logarithmic mean,” Mathematics Magazine, vol 48, no 2, pp 87–92, 1975 S Saitoh, V K Tuan, and M Yamamoto,...
- 6
- 302
- 0
Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt
... they are generalizations of the classical Hadamard and Haar transforms Definition Within the class Ω consider the family Ω of Hadamard-like orthogonal transforms such that all the spectral kernels ... Guevorkian, and H Sarukhanyan, On parameterized fast Haar- and Hadamard-like transforms of arbitrary order,” in Proceedings of the 3rd International Conference on Computer Science and Information ... transforms a priori having fast algorithms for their computation In particular, families of Haar-like, Hadamard-like, and slant-like transforms are defined based on this approach 2.1 The class of parametric...
- 14
- 484
- 0
ON A CLASS OF FOURTH-ORDER NONLINEAR DIFFERENCE EQUATIONS MAŁGORZATA MIGDA, ANNA MUSIELAK, AND EWA pptx
... β According to Lemma 2.5, we may regard an asymptotically constant solution as a “minimal” solution, and an asymptotically Qn,N solution as a “maximal” solution Now, we present a necessary and ... and M Sun, Oscillation properties of nonlinear difference equations, Portugal Math 52 (1995), no 1, 15–24 E Thandapani and I M Arockiasamy, Oscillatory and asymptotic properties of solutions of ... order nonlinear difference equations, New Progress in Difference Equations (B Aulbach, S Elaydi, and G Ladas, eds.), Taylor & Francis, London, 529–536, in press , Oscillation and nonoscillation theorems...
- 14
- 274
- 0
Word Grammar New Perspectives on a Theory of Language Structure. docx
... Grammar Surface Structures and HPSG Order Domains Takafumi Maekawa Introduction A Word Grammar Approach An Approach in Constructional HPSG: Ginzburg and Sag 2000 A Linearization HPSG Approach ... kinds of head and claims that every phrase has both a distributional head and a structural head, although he agrees that normally the same word is both distributional and structural head of a phrase ... its heart, and networks also loomed large at tihat time in the Stratificational Grammar of Lamb (1966; Bennett 1994) Another reason why stratificational grammar was important was that it aimed...
- 251
- 554
- 0
Báo cáo toán học: "On a System of Semilinear Elliptic Equations on an Unbounded Domain" potx
... and M Zuluaga, On a Nonlinear Dirichlet Problem Type at Resonance and Bifurcation, Partial Differential Equations, Pitman Research Notes in Math., Series 273, 1992 M Zuluaga, On a nonlinear elliptic ... solution for a quasilinear elliptic equation with a non Lipschitz nonlinearity, Commun In Partial Diff Equation 17 (1992) L C Evans, Partial Diff Equations, American Math Society, 1998 C Vargas and ... Mitidieri, A maximum principle for an elliptic system and applications to semilinear system, SIAM J Math Anal 17 (1986) 836–899 G Diaz, J I Diaz, and G Barles, Uniqueness and continum of foliated solution...
- 9
- 246
- 0
Báo cáo toán học: "On a Class of Constant Weight Codes" pptx
... first column of a normalized Hadamard matrix of order 4t, the set of all the rows of the remaining matrix can be seen (by replacing each occurrence of a −1 with 0) as a nonlinear code of length ... quasi-random character of the above defined subsets S(q; x) Thus, a codeword in C(q, n) can ‘safely’ be seen as a ‘random subset of Fq or, equally, as the output of an experiment of random and ... having a constant distance, by permitting a ‘small variation’ of the parameter d, while keeping a constant weight, say [n/2], for the codewords Our study of the codes C(q, 2) provides a partial...
- 13
- 348
- 0
Báo cáo toán học: "On a theorem of Erd˝s, Rubin, and Taylor on o choosability of complete bipartite graphs" pptx
... Problems and Results on 3-chromatic hypergraphs and some o a related questions, In Infinite and Finite Sets, A Hajnal et al., editors, Colloq Math Soc J Bolyai, 11, North Holland, Amsterdam, 609–627, ... hypergraphs with few colors, submitted [8] A. V Kostochka and D R Woodall, Density conditions for panchromatic colourings of hypergraphs, Combinatorica, 21 (2001), 515–541, [9] J Radhakrishnan and A ... Rubin, and Taylor) o A vertex t-coloring of a hypergraph H is panchromatic if each of the t colors is used on every edge of G Thus, an ordinary 2-coloring is panchromatic Some results on the...
- 4
- 255
- 0
Báo cáo toán học: "A Uniformly Distributed Statistic on a Class of Lattice Paths" doc
... Q as the first vertex strictly after P that lies weakly above LP rather than “that terminates a nonempty balanced subdiagonal subpath starting ˜ at P ” Then f is defined as f was This modification ... = B—and then no vertices actually get lowered Finally, delete P Figure gives an example of Case mAP < 1, Figure gives an example of Case mAP ≥ 1, and Figure gives the action of f on all paths ... strictly above y = x and is the terminal vertex of a nonempty balanced superdiagonal subpath of π If a line is active for π by virtue of (i), no other vertex on the line can meet the conditions of...
- 8
- 184
- 0
Báo cáo toán học: "A note on a problem of Hilliker and Straus" pps
... ∈ A + A has at least two different representations a + a , a, a ∈ A Finally, we give a lower bound for the size of a set A ⊆ Zp such that every element t ∈ A + A has at least K ≥ representations ... where A is such that every element of A + A has at least two representations, and B is an arbitrary subset of Zp The main result of this section can be stated as follows Theorem If A ⊆ Zp and ... a ∈ A, has at least two representations in S If a = then it is indeed the case, since ka = + · · · + = + (−1) + + · · · + For < a < zk we have ka = (a − 1) + (a + 1) + a + · · · + a k−2 Finally,...
- 8
- 338
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008