0

convert c into fortran procedure pointer

 fundamentals of engineering programming with c and fortran

fundamentals of engineering programming with c and fortran

Kỹ thuật lập trình

... internal combustion engines We can abstract the concept of engine to include machines in general as well as complex machines such as robots and vehicles To further the abstraction, we can include ... on counter Place all-meat patty on bottom piece of bun Place tomato slice on patty Place lettuce leaf on tomato Squirt special sauce on lettuce 1.2 The von Neumann Machine Architecture Replace ... program for converting from assembly code to machine code The code produced by the assembler is called an object code and must be linked to other codes to be useful The linking process is accomplished...
  • 223
  • 499
  • 0
Pointer in C

Pointer in C

Kỹ thuật lập trình

... typedef struct { char name[21]; char city[21]; char state[3]; } Rec; typedef Rec *RecPointer; RecPointer r; r = (RecPointer)malloc(sizeof(Rec)); The pointer r is a pointer to a structure Please ... structure instead of an integer In C, the code looks like this: #include struct rec { int i; float f; char c; }; int main() { struct rec *p; p=(struct rec *) malloc (sizeof(struct rec)); ... Structures Containing Pointers Structures can contain pointers, as shown below: typedef struct { char name[21]; char city[21]; char phone[21]; char *comment; } Addr; Addr s; char comm[100]; gets(s.name,...
  • 31
  • 616
  • 0
Convert ổ C sang NTFS

ConvertC sang NTFS

Cơ sở dữ liệu

... Click`n` See: Chạy chương trình Just Click`n` See Để tra c u từ điển ta bấm phím Shift right-click chuột vào từ c n tra 5 Danh sách phần mềm c i máy: Microsoft Office 2003 ( Word, Excel, Access, ... nhỏ gọn 10 CCleaner: Tiện ích dọn dẹp r c máy tính Danh sách phần mềm crack c thư m c c:\Soft: Click and See: Từ điển nhỏ gọn Portable UltraISO 9.30.2600 Portable CPU-Z v1.47: Xem c u hình máy ... Codec Pack v4.6.2: Codec xem file video Internet Download Manager 5.15 built 6: Trình download mạnh mẽ Yahoo Messenger 8.0 multi: C ng l c logon nhiều nick Foxit Reader v2.3: chương trình đọc...
  • 4
  • 486
  • 2
Convert ổ C sang NTFS (không dùng Hiren''''s Boot)

ConvertC sang NTFS (không dùng Hiren''''s Boot)

Tin học văn phòng

... Click`n` See: Chạy chương trình Just Click`n` See Để tra c u từ điển ta bấm phím Shift right-click chuột vào từ c n tra 5 Danh sách phần mềm c i máy: Microsoft Office 2003 ( Word, Excel, Access, ... nhỏ gọn 10 CCleaner: Tiện ích dọn dẹp r c máy tính Danh sách phần mềm crack c thư m c c:\Soft: Click and See: Từ điển nhỏ gọn Portable UltraISO 9.30.2600 Portable CPU-Z v1.47: Xem c u hình máy ... Codec Pack v4.6.2: Codec xem file video Internet Download Manager 5.15 built 6: Trình download mạnh mẽ Yahoo Messenger 8.0 multi: C ng l c logon nhiều nick Foxit Reader v2.3: chương trình đọc...
  • 4
  • 348
  • 0
Báo cáo khoa học: Insights into substrate and product traffic in the Drosophila melanogaster acetylcholinesterase active site gorge by enlarging a back channel ppt

Báo cáo khoa học: Insights into substrate and product traffic in the Drosophila melanogaster acetylcholinesterase active site gorge by enlarging a back channel ppt

Báo cáo khoa học

... different acetylthiocholine concentrations (pS curves) Theoretical curves were calculated according to the Scheme speci c rate equation, using the corresponding kinetic parameters from Table acetylcholinesterase ... anionic subsite tryptophan 86 to catalytic efficiency and allosteric modulation of acetylcholinesterase J Biol Chem 270, 2082–2091 Radic Z, Quinn DM, Vellom DC, Camp S & Taylor P (1995) Allosteric control ... EA ES S S Choline Acetate S Kp Kp b k2 a k3 SpEA SpES Choline Acetate KLL EAS S Kp SpEAS 2660 SpE Scheme Reaction scheme for the hydrolysis of acetylthiocholine by DmAChE S, acetylthiocholine;...
  • 6
  • 524
  • 0
Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx

Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx

Báo cáo khoa học

... 5¢-GGCCCAG GTGACTCAGCTATT-3¢; reverse, 5¢-AGGGCATCCGA GAATTCCTT-3¢), LAMP2 (forward, 5¢-TCAGCATTGC AAATAACAATCTCA-3¢; reverse, 5¢-CAGTCTGCTCT TTGTTGCACATATAA-3¢), CTGF (forward, 5¢-CA AGCTGCCCGGGAAAT-3¢; ... 5¢-GGACCAGGCA GTTGGCTCTA-3¢), JUN (forward, 5¢-GGATCAAGGC GGAGAGGAA-3¢; reverse, 5¢-TCCAGCCGGGCGATT-3¢), PLAU (forward, 5¢-CTGTGACCAGCACTGTCT CAGTTT-3¢; reverse, 5¢-CCCAGTGAGGATTGGATGA ACTA-3¢), ... 5¢UGACUUCCCUGGCCUAUUUUU-3¢, 5¢-ACAUUGAGC UCCUCUCUUGUU-3¢, 5¢-GAUAAGGUUGCUUCAGU UAUU-3¢ and 5¢-ACAGUACGCUAUGAAACUAUU-3¢, respectively As a negative control, we used an NT siRNA (5¢-UAGCGACUAAACACAUCAA-3¢) or a RISC-free...
  • 16
  • 494
  • 0
Báo cáo khoa học: The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy pdf

Báo cáo khoa học: The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy pdf

Báo cáo khoa học

... 5¢-CGCGGATCCTGGTCTTTCCAAAATATTC AGGCCA-3¢ and reverse, 5¢-GTCCTCGAGGTACATCA CATCTCTGAT-3¢ After digestion, the PCR-amplified fragment was cloned into a modified BamHI ⁄ XhoI digested 1233 C- type lectins in the ... CV864030 CV864031 CV864032 Lectin C- type domain containing protein [C elegans] (5e-07) C- type lectin [A japonica] (4e-16) Leucine-rich repeat-containing protein [M musculus] (9e-79) CV864033 CV864034 ... immunoreactive protein was detected using the Super Signal Pico West chemiluminescent system (Pierce Chemical Co., Rockford, IL), followed by exposure to Cl-XPosure film (Pierce Chemical Co.) for...
  • 15
  • 379
  • 0
C++ Lab 16 Pointers potx

C++ Lab 16 Pointers potx

Kỹ thuật lập trình

... "; cin >> x; pointerx = &x; //pointerx gets memory location of variable x pointery = pointerx; cout
  • 5
  • 325
  • 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo khoa học

... Tecnologica (BID 802/OC-AR), Consejo Nacional de Investigaciones Cientı´ ficas y ´ ´ Tecnicas (CONICET), Secretarı´ a de Ciencia y Tecnica de la Univer´ ´ sidad Nacional de Cordoba y Agencia Cordoba Ciencia ... Agencia Nacional de Promocion Cientı´ fica y Tecnologica de la Secretarı´ a de Ciencia y Tecnologı´ a del Ministerio de Cultura y ´ ´ ´ Educacion en el marco del Programa de Modernizacion Tecnologica ... of mM nonradioactive nitrotyrosine in the incubation system led to reduced incorporation of radioactivity In this case, as calculated from the speci c radioactivity and tubulin content in the...
  • 9
  • 518
  • 0
Naveen toppo, hrishikesh dewan   pointers in c  a hands on approach 2013

Naveen toppo, hrishikesh dewan pointers in c a hands on approach 2013

Kỹ thuật lập trình

... add, COMDAT ; 00000 0c0 H ; 00000030H ; ccccccccH ; add Chapter ■ Memory, Runtime Memory Organization, and Virtual Memory PUBLIC _wmain EXTRN RTC_CheckEsp:PROC ; Function compile flags: /Odtp /RTCsu ... the cache line in L1 cache In this example, L1 cache has 64 bytes, so that much data is copied into L1 cache Chapter ■ Memory, Runtime Memory Organization, and Virtual Memory L2 Cache L1 Cache ... for cache memories as they are faster than DRAM Also, there exist dedicated instruction cache and data cache in some architectures, such that instruction code will reside in the instruction cache...
  • 161
  • 1,056
  • 1
Richard reese  -  understanding and using c pointers

Richard reese - understanding and using c pointers

Kỹ thuật lập trình

... We cannot dereference a constant pointer to change what the pointer references, but we can change the pointer The pointer value is not constant The pointer can be changed to reference another constant ... previous section Read‐ ing complex declarations from right to left helps clarify these types of declarations: const int * const cpci = &limit; const int * const * pcpci; A pointer to a constant pointer ... equivalent: const int *pci; int const *pci; Constant pointers to nonconstants We can also declare a constant pointer to a nonconstant When we this, it means that while the pointer cannot be changed,...
  • 226
  • 650
  • 0
INSTRUCTIONS FOR FLORIDA FAMILY LAW RULE OF PROCEDURE FORM 12.902(c), FAMILY LAW FINANCIAL AFFIDAVIT (LONG FORM)(09/12) potx

INSTRUCTIONS FOR FLORIDA FAMILY LAW RULE OF PROCEDURE FORM 12.902(c), FAMILY LAW FINANCIAL AFFIDAVIT (LONG FORM)(09/12) potx

Tài chính doanh nghiệp

... Debts (add column B) C Nonmarital (Check correct column) $ Florida Family Law Rules of Procedure Form 12.902 (c) , Family Law Financial Affidavit (Long Form) (09/12) C NET WORTH (excluding contingent ... you complete Instructions for Florida Family Law Rules of Procedure Form 12.902 (c) , Family Law Financial Affidavit (Long Form) (09/12) IN THE CIRCUIT COURT OF THE IN AND FOR JUDICIAL CIRCUIT, COUNTY, ... NUMBERS Market Check the line next to any asset(s) which you are requesting the judge award Value to you Cash (on hand) C Nonmarital (Check correct column) husband wife $ Cash (in banks or credit unions)...
  • 13
  • 328
  • 0
Báo cáo Y học: Cytochrome c from a thermophilic bacterium has provided insights into the mechanisms of protein maturation, folding, and stability potx

Báo cáo Y học: Cytochrome c from a thermophilic bacterium has provided insights into the mechanisms of protein maturation, folding, and stability potx

Báo cáo khoa học

... & McRee, D.E (2000) Integrity of Thermus thermophilus cytochrome c5 52 synthesized by Escherichia coli cells expressing the host-speci c cytochrome c maturation genes, ccmABCDEFGH: biochemical, ... haem-attachment and signal-cleavage sites for Paracoccus denitrificans cytochrome c5 50 probes pathway of c- type cytochrome biogenesis in Escherichia coli Mol Microbiol 19, 1193– 1204 Sambongi, Y., Crooke, ... be common in prokaryotes and eukaryotes to some extent [13] Among the ccm gene products, Escherichia coli CcmE was first biochemically characterized as a factor transferring a heme to the cytochrome...
  • 7
  • 369
  • 0
Báo cáo Y học: Investigations into the mechanisms used by the C-terminal anchors of Escherichia coli penicillin-binding proteins 4, 5, 6 and 6b for membrane interaction ppt

Báo cáo Y học: Investigations into the mechanisms used by the C-terminal anchors of Escherichia coli penicillin-binding proteins 4, 5, 6 and 6b for membrane interaction ppt

Báo cáo khoa học

... Myr2-PCho and Myr2-PEtn membranes with Tc being recorded as 13 and 42 C, respectively, and in each case, the change was accompanied by a concomitant increase in membrane fluidity (Fig 6A,B) In contrast, ... respectively In each case, the major contribution to P4 came from b-sheet structures (1625–1640 cm)1) Significant levels of a-helical structure (1650–1655 cm)1) can be seen in the presence of ... amphiphilicity and, in common, possess glycine rich hydrophilic faces with wide hydrophobic faces rich in bulky amino acid residues The a-helices of PBP4 and PBP6b show ill-defined faces and few structural...
  • 9
  • 472
  • 0
A TUTORIAL ON POINTERS AND ARRAYS IN C

A TUTORIAL ON POINTERS AND ARRAYS IN C

Kỹ thuật lập trình

... function decays into the address of that function in the code segment Thus we need to use a pointer to a function In this case the comparison function Pointers to functions must match the functions ... is happening, we can proceed to creating our own replacement for the standard strcpy() that comes with C It might look like: char *my_strcpy(char *destination, char *source) { char *p = destination; ... change the contents of that which is pointed to by source, such as: *source = 'X'; which would normally change the first character of the string to an X The const modifier should cause your compiler...
  • 53
  • 379
  • 0
Chapter 05 pointer string bài giảng c c++

Chapter 05 pointer string bài giảng c c++

Kỹ thuật lập trình

... truy c p © 2004 Trần Minh Châu FOTECH VNU Chương 1 using std::cout; using std::endl; #include 10 11 void convertToUppercase( char * ); 12 13 14 15 int main() { char phrase[] = "characters ... error: cannot modify a const object 22 23 } // end function f Lỗi sinh biên dịch d:\cpphtp4_examples\ch05\Fig05_12.cpp(21) : error C2 166: l-value specifies const object ©2004 Trần Minh Châu FOTECH ... Châu FOTECH VNU Chương 3 5.1 Giới thiệu • Con trỏ (Pointer) – Mạnh, khó làm chủ – C t c dụng truyền tham chiếu (pass-by-reference) – C liên quan chặt chẽ đến mảng xâu • Biến trỏ (Pointer variable)...
  • 77
  • 379
  • 0
c 48. That jeweler''''s shop was broken into last night and was got .................. with gems doc

c 48. That jeweler''''s shop was broken into last night and was got .................. with gems doc

Kỹ năng nói tiếng Anh

... intelligent b clever c timid d educational d Test 45 Pronunciation a supper b hungry c pull d punish c a have b chance c hand d stand b a buck b duck c reduce d structure c a borrow b grow c sparrow ... to before he can walk a creep b crawl c stride d stroll b Test 43 Pronunciation a teacher b headache c chair d cheat b a none b stone c bone d alone a a because b clause c cause d aunt d ... b stressful c stressing d stress b 19 The more careless he is in his work, the more …………… he is a successful b unsuccessful c unsuccess d success b 20 The conductor often collects the bus ...
  • 43
  • 369
  • 0
d. of c 219. You should get into the habit of ……………… at least one newspaper daily. a. pot

d. of c 219. You should get into the habit of ……………… at least one newspaper daily. a. pot

Kỹ năng nói tiếng Anh

... number b select group c huge crowd d large c 341 He’s just arrived to find his wife in tears a embarrassed b panicky c crying d confused c 342 People have a …………… for special occasions, such as a ... bombed b protected c left (because of danger) d attacked c 365 She offered a silly excuse a took b gave c considered d accepted b 366 It must be ……………… more than that a worth b cost c costly d expensive ... part of c 372 The teacher crossed out several words in my composition a emphasized b corrected c added d cancelled b 373 To check out of a hotel is to …………… a register it b leave it c complain...
  • 28
  • 416
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

Hóa học - Dầu khí

... Pure LC (Roche Diagnostics Ltd UK,) according to the MagNA Pure LC Total Nucleic Acid Isolation Kit protocol (Catalogue No: 03038505001, Roche Diagnostics Ltd., UK) from 25 μl of an unfractionated ... AAGGCCGTCCTGTTGA; inner forward, IF (I), GCATGGGATATGATGATGAA; inner reverse, IR (I), GTCCTGTTGATGTGCCA The PCR reactions were performed with the proofreading Pwo DNA polymerase (Roche Molecular ... origin of quasispecies: cause or consequence of chronic hepatitis C viral infection? J Hepatol 2005, 42:408-417 Kenny-Walsh E: Clinical outcomes after hepatitis C infection from contaminated anti-D...
  • 9
  • 288
  • 0
POINTER TRONG C - CHƯƠNG 9 pdf

POINTER TRONG C - CHƯƠNG 9 pdf

Kỹ thuật lập trình

... *ps = “abcd”; char const *ps = “abcd”; Khai báo biến pointer (tt) Lưu ý: Vi c đặt const trư c hay sau dấu * khai báo pointer kh c const trư c * : pointer trỏ đến đối tượng * trư c const : pointer ... } Con trỏ trỏ Biến pointer khai báo c p chỗ nhớ ⇒ biến pointer c địa C cho phép khai báo biến pointer trỏ đến đối tượng pointer Pointer trỏ đến đối tượng c kiểu tùy ý C pháp: kieu **ten_con_tro; ... biến pointer C có hàm chuẩn để c p phát nhớ động: hàm malloc() hàm calloc(); nằm trong: stdlib.h alloc.h void *malloc(size_t size); void *calloc(size_t nitems, size_t size); Pointer vi c định...
  • 70
  • 312
  • 0

Xem thêm