control of food intake as a function of fat

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Ngày tải lên : 08/03/2014, 10:20

... pH range from 5.3 to Tsuruga and Shikama [21] conﬁrmed that the fast phase of oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain ... of pH on the auto-oxidation of Hb A0 has been the subject of several studies Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of ... on the auto-oxidation of cross-linked Hb was studied The rate of decrease of the concentration of oxyHb increased as the pH was lowered over the range from pH 9.0–5.8 (data not shown) As was observed...

6
748
0

Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness pot

Ngày tải lên : 23/03/2014, 01:20

... contact angle of water was measured as a control on a clean (as defined in experimental section) silicon substrate and was 36.0° The contact angle of water was determined for the polymer brush samples ... range of temperatures used Although the value of permittivity began at a reasonable value, it increased as the temperature increased This increase could have been caused by a build up of charge ... 25°C and the heating process was repeated for a second run All of these tests used nitrogen as a purge gas The glass transition function in TA Instrumental Analysis was used to calculate the Tg of...

80
375
0

Báo cáo vật lý: "The Hidden Property of Arrhenius-type Relationship: Viscosity as a Function of Temperature" doc

Ngày tải lên : 07/08/2014, 14:20

... to this research They are: Ms Azira Amran, Mr Mahmood Sulaiman, Mrs Siti Zalaikhar, Mr Rozimi and Ms Mazalina Viscosity as a Function of Absolute Temperature 38 REFERENCES Fasina, O O & Colley, ... Malaya, NTC, Kuala Lumpur, 4–5 May 2009, 58–65 Magerramov, M A. , Abdulagatov, A I., Abdulagatov, I M & Azizov, N D (2007) Viscosity of tangerine and lemon juice as a function of temperature and ... Queiroz, A J D M., De Figueiredo, R M F., Da Silva, C L & Mata, M E R M C (2007) Rheological behaviour of honey from Serjania glabrata flowers, Revista Brasileira de Engenharia Agricola e Ambiental,...

10
496
1

Báo cáo khoa học: "Regional distribution of acoustic-based lung vibration as a function of mechanical ventilation mode" docx

Ngày tải lên : 13/08/2014, 03:20

... image analysis and raw numerical data calculation In contrast to image analysis, the numerical method was not affected by normalization The correlation of vibration energy and airflow in healthy ... the expansion of the lower lung region whereas areas in the upper and the middle regions decreased (Table 3) Assessment of relative percentage changes in areas revealed an increase in area in the ... analysis Normalization was applied to a predetermined range of frames Within a frame, the areas with the highest vibration energy are represented as black in a gray-level scale and the areas with...

13
310
0

Báo cáo y học: " Assessment of FIV-C infection of cats as a function of treatment with the protease inhibitor, TL-3" pot

Ngày tải lên : 13/08/2014, 13:20

... Peak Viremia Asymptomatic Symptomatic 10 12 Peak Viremia Average *p < 0.05 Figure Plasma viral loads of FIV infected cats as a function of TL-3 treatment and disease Plasma viral loads of FIV infected ... Serologicals (Norcross, GA) The primer sequences used for real-time PCR are as follows: FIV reverse-transcriptase forward: 5'-ACTGAACCTGACCGTACAGATAAATTACAGGAA GAACCCCCATA-3' FIV reverse-transcriptase ... was used as a template for PCR reactions using 5' primer MFIVCPL5' (5'-GATTTATAAATCATATG GCATATAATAAAGTGGGTACCACTACAACATTAG-3'), which adds an NdeI restriction site, methionine, and alkaline to...

12
323
0

Báo cáo y học: "Changes in regional distribution of lung sounds as a function of positive end-expiratory pressure" potx

Ngày tải lên : 13/08/2014, 16:20

... distribution along the cephalocaudal axis A larger ratio suggested increased sound in the apical areas and a smaller ratio increased sound in the diaphragmatic areas Distribution was considered ... the apical to the diaphragmatic lung areas was observed during PEEP increase This shift was not correlated with significant change in VT but was associated with an increase in Cdyn High repeatability ... representative frame (or map) at peakinspiratory flow was automatically selected and displayed on the screen (Figure 2) This map was also quantified by the software and presented as the percentage of...

10
531
0

Báo cáo y học: "A general framework for quantifying the effects of DNA repair inhibitors on radiation sensitivity as a function of dose" pptx

Ngày tải lên : 13/08/2014, 16:21

... flasks was calculated in the usual way For drug-treated flasks, surviving fraction was calculated using the mean, unirradiated, drug-free plating efficiency as the denominator This method revealed ... drug-treated case; and δx – where "x" is any of the parameters above – is the variation on x between the control and case under study General least square fitting was used and the significance of terms ... observation that δz was a significant parameter in all cases, and that the magnitude and direction of this effect varied according to cell line and confluence, suggests that this variable is an...

7
320
0

Báo cáo y học: "Gene expression response in target organ and whole blood varies as a function of target organ injury phenotype" ppsx

Ngày tải lên : 14/08/2014, 20:22

... triglycerides In addition, an enzymatic activity for the following proteins was measured: alanine aminotransferase, alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, and sorbitol ... final manuscript Additional data files The following additional data are available with the online version of this paper Additional data file is a table detailing the histopathological scores as ... USA) and serum was separated Clinical chemistry analysis was performed on all rats using a COBAS MIRA (Roche Diagnostics, Montclair, NJ, USA) using commercially available reagents from Equal...

13
284
0

computational and experimental analyses of transcriptional regulation as a function of dna sequence

Ngày tải lên : 14/11/2014, 06:05

183
185
0

top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern

Ngày tải lên : 22/12/2014, 22:04

... resonance decaying in a top-antitop pair, using ATLAS data at center -of- mass √ energy of s = TeV The latter analysis is repeated for ATLAS data col√ lected with s = TeV Performance studies of b-tagging ... described by a Lagrangian density that can be separated into a gauge term, a matter term, a Yukawa term and a Higgs term [30]: LSM = LMatter + LGauge + LYukawa + LHiggs The matter Lagrangian contains ... models, so that a comparison of the measurements and searches in data and simulation can be used to test proposed extensions of the Standard Model A comparison of the data and the simulated result...

251
712
0

A study on the mutual coupling effects between 2 rectangular patch antennas as a function of their separation and angles of elevation

Ngày tải lên : 26/09/2015, 10:43

... battle field to commercial enterprises, the microstrip antenna is fast replacing many conventional antennas The advantages and disadvantages of the Microstrip Antenna are tabulated below: Advantages ... without antennas Antennas are so intricately intertwined with radio wave communications, and so important a part of it, that it has developed a life of its own Today, the number of different types of ... for arrays Compatible with Integrated Circuits Difficult to achieve polarization purity Simple arrays readily created Table 1.1: The Advantages and Disadvantages of Microstrip Antennas It is actually...

104
329
0

Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided

Ngày tải lên : 30/09/2015, 16:58

... Descriptive Statistics (includes all cases) 178 Table A6 : Summary of Descriptive Statistics for AREs and CARs 179 Table A7 : ARE and CAR Means and Standard Deviations for No Rationale and Rationale Groups ... rationale vs no rationale categories 110 Figure 14: Comparison of average CARs of rationale vs no rationale categories 111 Figure 15: Comparison of average AREs by primary rationale and overall ... 21: Graph of average CARs by size of reverse split factor 128 Figure 22: Graph of average CARs classified by average twoyear growth rate in revenues 131 Figure 23: Graph of average CARs classified...

217
227
0

Cardiovascular responses as a function of ethnicity, gender, 5HTTLPR genotype, dispositional anger and negative affect

Ngày tải lên : 02/10/2015, 22:48

... leading cause of death after cancer (Seow & Lee, 1994) As of 1999, Singapore’s age-standardized CHD death rate (100/100,000) was among the highest of Southeast Asian nations (higher than Japan (22/100,000) ... rate that was 1.81 times higher than Malay males and 2.69 times higher than Chinese males (Registry of Births and Deaths, 1991) Malay males had an average hypertension mortality rate that was ... et al., 2000) These measures were chosen as indicators of CVR as previous research has shown that they are associated with progression of atherosclerosis as well as the development of CHD (Kamarck...

143
202
0

The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products

Ngày tải lên : 25/10/2013, 05:20

... dominica Salvia fruticosa Salvia of cinalis Salvia sclarea Satureja thymbra Thymus vulgaris Geraniaceae Apiaceae Apiaceae Lamiaceae Rutaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae ... vulgare Laurus nobilis Lavandula of cinalis Majorana siriaca Matricaria camomilla Mentha piperita M rotundifolia Apiaceae Apiaceae Poaceae Apiaceae Lauraceae Lamiaceae Lamiaceae Asteraceae Lamiaceae ... arborescens A judaica Carum carvi Apiaceae Compositae Compositae Apiaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae Citrus limonum Rutaceae Coriandrum sativum Cuminum cyminum Cymbopogon citrates Foeniculum...

20
483
0

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

12
616
0

Nitrosamine and related food intake and gastric and oesophageal cancer risk: A systematic review of the epidemiological evidence ppt

Ngày tải lên : 06/03/2014, 02:21

... M, Natsukawa S, Shaura K, Koizumi Y, Kasuga Y, Hanaoka T, Tsugane S Association of Helicobacter pylori infection and environmental factors in non-cardia gastric cancer in Japan Gastric Cancer ... log scale Figure A: Meat intake and gastric cancer (case -control studies); (a) Meat intake: (a1 ) meat (a2 ) pork (a3 ) grilled meat (a4 ) mutton (a5 ) beef (a6 ) red meat; B: Processed meat and gastric ... Rao DN, Ganesh B, Dinshaw KA, Mohandas KM A casecontrol study of stomach cancer in Mumbai, India Int J Cancer 2002; 99: 727-731 Cai L, Zheng ZL, Zhang ZF Risk factors for the gastric cardia cancer:...

8
555
0

American Negro Slavery A Survey of the Supply, Employment and Control of Negro Labor as Determined by the Plantation Regime docx

Ngày tải lên : 08/03/2014, 00:20

... soldiers; and each with its outlying factories had a staff of perhaps a dozen factors, as many sub-factors, twice as many assistants, and a few bookkeepers and auditors, as well as a corps of white artisans ... Arab dhows began to take slave cargoes from the east coast of Africa as far south as Mozambique, for distribution in Arabia, Persia and CHAPTER I western India On these northern and eastern flanks ... negro slaves be greatly increased as a means of preventing industrial collapse, but a delegation of Jeronimite friars and the famous Bartholomeo de las Casas, who had formerly been a Cuban encomendero...

268
608
0

Fermentation as a Method of Food Processing ppt

Ngày tải lên : 24/03/2014, 04:20

... standard of a food is based on the processing and handling of the food, as well as on the conditions of the raw materials A food item prepared with water contaminated with pathogenic microorganisms ... standard of a food is based on the processing and handling of the food, as well as on the conditions of the raw materials A food item prepared from water contaminated with pathogenic microorganisms ... German salami (smoked), Italian salami, Lebanon bologna (sausage), Longaniza (sausage), and Teewurst are typical fermented meat products of Europe While paak made of fish and cereal by lactic acid...

65
538
0

Báo cáo khoa học: Roles of prolactin-releasing peptide and RFamide related peptides in the control of stress and food intake potx

Ngày tải lên : 29/03/2014, 21:20

... 100, 15247–15252 53 Takayasu S, Sakurai T, Iwasaki S, Teranishi H, Yamanaka A, Williams SC, Iguchi H, Kawasawa YI, Ikeda Y, Sakakibara I et al (2006) A neuropeptide ligand of the G protein-coupled ... AXOR12, KISS-1R) GPR103 (AQ27, SP9155) Decrease in vasopressin release Increase in the release of ACTH, oxytocin, vasopressin and prolactin Increase in the release of ACTH, oxytocin and prolactin ... which are involved in stress and energy balance AMY, amygdala; ARC, arcuate nucleus; BST, bed nucleus of the stria terminalis; DMH, dorsomedial hypothalamus; LHA, lateral hypothalamic area; NTS,...

8
489
0

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Ngày tải lên : 30/03/2014, 15:20

... Analysis of transglutaminase protein substrates by functional proteomics Protein Sci 12, 1290–1297 Facchiano AM, Facchiano A & Facchiano F (2003) Active sequences collection (ASC) database: a ... sequences as substrate Proc Natl Acad Sci USA 81, 7017–7020 Porta R, Esposito C, Metafora S, Pucci P, Malorni A & Marino G (1988) Substance P as a transglutaminase substrate: identiﬁcation of the reaction ... nucleotide-binding activity of tissue transglutaminase and its regulation of transamidation activity Proc Natl Acad Sci USA 99, 2743–2747 Ahvazi B, Boeshans KM, Idler W, Naxa U, Steinert PM & Rastinejad F...

17
440
0