content but is insufficient to provide the property c
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
Ngày tải lên :
18/06/2014, 22:20
... VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; ... recombinant S RNA segments Checking of specificity of RT-PCRs for the wt and the Checking of specificity of RT-PCRs for the wt and the recombinant S RNA segments Lines 1–3: products of RT-PCR ... B PCR-amplicons (118 bp), obtained in RT- PCR with the primers RECF738 and RECR855 (specific for the recombinant virus) on RNA from infected cells collected on passages to 10 NC, negative controls...
- 5
- 483
- 0
Báo cáo hóa học: " Vaccinia virus lacking the deoxyuridine triphosphatase gene (F2L) replicates well in vitro and in vivo, but is hypersensitive to the antiviral drug " pot
Ngày tải lên :
20/06/2014, 01:20
... RWM contributed to the conception of the studies and the critical review of the manuscript PCT contributed to the design of experiments, the acquisition and analysis of data and the critical ... contributed to the conception of the studies and the critical review of the manuscript DCQ contributed to the design of the experiments and analysis of the data KAK contributed to the acquisition and interpretation ... declare that they have no competing interests Authors' contributions MNP contributed to the design of experiments, analysis of the data and the drafted the manuscript ERK contributed to the conception...
- 6
- 330
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
Ngày tải lên :
20/06/2014, 04:20
... VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; ... recombinant S RNA segments Checking of specificity of RT-PCRs for the wt and the Checking of specificity of RT-PCRs for the wt and the recombinant S RNA segments Lines 1–3: products of RT-PCR ... B PCR-amplicons (118 bp), obtained in RT- PCR with the primers RECF738 and RECR855 (specific for the recombinant virus) on RNA from infected cells collected on passages to 10 NC, negative controls...
- 5
- 430
- 0
Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf
Ngày tải lên :
21/12/2013, 19:15
... numbers To configure the switch type and spid numbers use the following commands Router(config)#hostname Tokyo Tokyo(config)#enable secret class Tokyo(config)#isdn switch-type basic-ni Tokyo(config)#interface ... Tokyo(config-if)#interface dialer Tokyo(config-if)#encapsulation ppp Tokyo(config-if)#ppp authentication chap Tokyo(config-if)#interface dialer Tokyo(config-if)#encapsulation ppp Tokyo(config-if)#ppp authentication ... Moscow(config-if)#interface bri Moscow(config-if)#encapsulation ppp Moscow(config-if)#ppp authentication chap Moscow(config-if)#interface dialer Moscow(config-if)#encapsulation ppp Moscow(config-if)#ppp...
- 8
- 419
- 0
Apex Clearing Corp. All Mutual Funds: Data as of Jan 4th 2013, but is subject to change ppt
Ngày tải lên :
07/03/2014, 08:20
... FIDELITY ADVISOR STOCK SELECTOR MID CAP CLASS C C 315805713 FMCEX BACK END FIDELITY ADVISOR STOCK SELECTOR MID CAP CLASS I I 315805606 FMCCX NO LOAD FIDELITY ADVISOR STOCK SELECTOR MID CAP CLASS T ... CAPITAL ACCUMULATION CLASS A A 131649303 CCAFX CALVERT CAPITAL ACCUMULATION CLASS B B 131649600 CWCBX BACK END CALVERT CAPITAL ACCUMULATION CLASS C C 131649402 CCACX BACK END CALVERT CONSERVATIVE ... N/A BLACKROCK Y 1000 50 100 4:00 PM BLACKROCK BALANCED CAPITAL CLASS B B 0925 1C2 09 MBCPX BACK END NON-NTF N/A BLACKROCK N 1000 50 100 BLACKROCK BALANCED CAPITAL CLASS C C 0925 1C3 08 MCCPX BACK END...
- 100
- 1.1K
- 0
Báo cáo khoa học: Investigations into the ability of an oblique a-helical template to provide the basis for design of an antimicrobial anionic amphiphilic peptide pot
Ngày tải lên :
07/03/2014, 12:20
... promote toxicity to E coli by a lytic-type mechanism involving disturbance of lipid acyl chains within the membrane core [47] It is well established that the packing characteristics of component ... in the presence of AP1, further supporting the suggestion that this instability may contribute to the susceptibility of E coli to the antimicrobial action of the peptide Discussion The biological ... monitored and recorded Thermodynamic analysis of compression isotherm data Thermodynamic analysis of compression isotherms was used to investigate the molecular interactions and dynamic behaviour...
- 12
- 688
- 0
Báo cáo y học: " Harmonization of monographic standards is needed to ensure the quality of Chinese medicinal materials" docx
Ngày tải lên :
13/08/2014, 15:21
... pesticide detection Microscopic examination/authentication identifies the characteristics of tissues, cells or cell contents in sections, powders or surface on slides of CMMs Chemical identification ... statutory status was accorded to Chinese medicine in Hong Kong and the Chinese Medicine Council of Hong Kong (CMC) was established [20] to regulate Chinese herbal medicines with assistance from the ... applicable to the quality control of Chinese crude drugs [8] as it includes quality aspects such as macroscopic/microscopic authentication, chemical identification, bioactive compounds and metal elements,...
- 5
- 343
- 0
Cancer Research UK’s strategy 2009–2014: Cancer Research UK’s aim is to reduce the number of deaths from cancer. Our future plans are ambitious, but they are in line with the challenge and the responsibility we face. docx
Ngày tải lên :
22/03/2014, 16:21
... inflammatory responses to cancer, invasion and metastasis and genetic pre-disposition to cancer Scientists at Cancer Research UK and across the world are building on these discoveries to develop ... uptake of cancer screening among the public Providing access to world-class cancer services and treatment We will continue to constructively challenge the Government to develop policies, legislation ... will know how to reduce their risk of cancer Three-quarters of the UK public will be aware of the main lifestyle choices they can make to reduce their risk of getting cancer • The number of smokers...
- 32
- 396
- 0
Báo cáo khoa học: The activation of gelsolin by low pH The calcium latch is sensitive to calcium but not pH docx
Ngày tải lên :
23/03/2014, 21:20
... exist, first, a fluorescence quenching at % 0.1 lM [calcium]; second, at % lM an increase in fluorescence intensity These conformational changes can be correlated with the occurrence of the two constitutive ... domains caused either by the occupancy by other calcium ions, or by the presence of protons We have shown that the helix latch and the G2 to G4–6 interaction in general is not reduced by low pH It is ... that occur in cells may act in part through the actin cytoskeleton We have shown that there is a clear difference between calcium- and pH-induced activation of gelsolin Future challenges are to...
- 8
- 320
- 0
This questionnaire is designed to investigate teachers’ attitude towards the applicability of process approach in teaching writi
Ngày tải lên :
07/09/2013, 13:51
... researcher of this thesis unselected them to avoid causing too much inconvenience to those students There are 10 teachers of English at the school and all of them were selected as the subjects of the ... in the composition for the teacher to correct In other words, in the process approach the focus of 10 teaching and learning is placed on the process of writing rather than the final product In ... the T and S on the topics and exercises in the textbook According to the result shown in the table, the majority of the subjects indicated that the topics and exercises in the textbook were interesting...
- 31
- 560
- 2
Tài liệu Báo cáo khoa học: The PA-TM-RING protein RING finger protein 13 is an endosomal integral membrane E3 ubiquitin ligase whose RING finger domain is released to the cytoplasm by proteolysis ppt
Ngày tải lên :
18/02/2014, 08:20
... localize to the nucleus constitutively The APP ICD must form a complex with the nuclear adaptor Fe65 and the histone acetyltransferase Tip60 in order to target to the nucleus [61,62] Other ICDs ... FEBS J P Bocock et al Proteolytic regulation of RNF13 failure to produce the characteristic polyubiquitin ladder This indicates that catalysis of polyubiquitin chains is speci c to the RING-H2 ... Expression Laboratories, UNC-CH, which is under the direction of H.-S Kim Cell sorting was performed at the UNC-CH Flow Cytometry Facility, which is under the direction of L Arnold This work was supported...
- 18
- 483
- 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
Ngày tải lên :
19/02/2014, 17:20
... decreased as the chase time elapsed However, this decline is not simply accounted for by the secretion of the mutant protein into the medium, as no band was detectable even in the h chase culture ... Taking these values into consideration, the relative speci c enzyme activity of the mutant protein was calculated to be about one third of that of the wild type (Fig 7C) In contrast to the culture ... is rapidly secreted out of the cell (Fig 4C) Catalytic activity of TNSALP (1559delT) Aggregation of TNSALP (1559delT) Figure shows cytohistochemistry for alkaline phosphatase In contrast to the...
- 14
- 445
- 0
The nobel prize in physiology or medicine 2010 is awarded to
Ngày tải lên :
23/02/2014, 20:45
... thành, c làm chúng thụ tinh Nhưng c ch không hiệu tb trứng người, chúng Thụ tinh ống nghiệm tuân theo vòng đời kh c R.E c làm thứ, liên t c điều chỉnh m c độ hormones, môi trường nuôi c y, thời ... Nghiên c u chống lại gió Mọi vi c hứa hẹn, nghiên c u ngày gây tranh c i Nhiều giám m c nhà đạo đ c h c đưa dự án bu c phải dừng lại, ng kh c lại ủng hộ Nhiều nhà phê bình cho nghiên c u thật ... louise nâu Alistair tế bào trứng trưởng thành sau macdonald Ảnh: phòng c nh giới chu kì kinh nguyệt tự nhiên Bằng c ch phân tích m c độ hormone bệnh nhân, họ x c định thời gian tối ưu cho việc...
- 7
- 370
- 1
Báo cáo khoa học: Arabidopsis thaliana CYP77A4 is the first cytochrome P450 able to catalyze the epoxidation of free fatty acids in plants potx
Ngày tải lên :
07/03/2014, 03:20
... demonstrated the existence in plants of a cytochrome P450 able to epoxidize the double bonds of fatty acids The terminal olefin 11-dodecenoic acid is converted into 11,12-epoxylauric acid by a cytochrome ... 5¢-CCCCAGATCTATGTTTCCTCT AATCTC-3¢ and 5¢-GGGGGGTACCCTAAATCCTTGGT TTG-3¢ were used as forward and reverse primers, respectively PCR was carried out with IsisÔ DNA polymerase (Qbiogene, Illkirch, ... obtained when incubation was carried out with the cytosolic fraction of A thaliana (Fig 7C) Together, these experiments show that vernolic acid produced by CYP77A4 can be converted to the corresponding...
- 17
- 544
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
Ngày tải lên :
07/03/2014, 09:20
... so the fact that mutations at the M3 site not change kcat is unsurprising There is probably no change in active site contents The WH in prokaryotic enzymes is located on the opposite side of the ... (Ser155) in the monomer bound to the active site (Fig 3B) This feature might be related to the mechanism of the enzyme (see Discussion) 3132 Discussion Overall structure The structure of SaSTP is very ... Arg13 (C) Also, the general acid in HsSTP, His62, is shown as sticks with gray carbon atoms the overall conformation of the flap subdomain The conformations are correlated with the presence or absence...
- 10
- 542
- 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
Ngày tải lên :
15/03/2014, 00:20
... are denoted T and CT, respectively The protonated monoisotopic experimental masses (MH+exp) and the calculated mass difference (p.p.m.) with the theoretical monoisotopic mass of the identified peptide ... Ure2p, critical for assembly into fibrils To further identify the regions involved in Ure2p–Ssa1p interaction, we set up a chemical cross-linking strategy coupled to the identification of the chemically ... 325 is not located within the client binding pocket of the chaperone Its lack of modification upon complex formation can only be attributed to a conformational rearrangement within Ssa1p that occurs...
- 12
- 510
- 0
Economic Effects of Reducing the Fiscal Restraint That Is Scheduled to Occur in 2013 docx
Ngày tải lên :
15/03/2014, 20:20
... Fiscal Policy The Congressional Budget Office (CBO) analyzes the economic effects of changes in fiscal policy by using models and historical evidence to estimate the direct and indirect effects ... equal the midpoints of the ranges used by CBO ECONOMIC EFFECTS OF REDUCING THE FISCAL RESTRAINT THAT IS SCHEDULED TO OCCUR IN 2013 Box CBO’s Approach to Estimating the Economic Effects of Changes ... 2 ECONOMIC EFFECTS OF REDUCING THE FISCAL RESTRAINT THAT IS SCHEDULED TO OCCUR IN 2013 expects—with the economy projected to contract at an annual rate of 1.3 percent in the first half of the...
- 10
- 538
- 0
The aim of the research is to study the factors affecting the lifetime of pulsed plasma thruster
Ngày tải lên :
15/03/2014, 23:15
... Skin cancer: • Is ~50% of all cancer cases • Has > million cases diagnosed each year • Causes person to die every hour Causes of the increase: • Decrease ozone protection • Increased time in the ... energy is in each packet but also to the total number of packets arriving at a given location (such as our skin) • Total Energy depends on many factors including the intensity of sunlight • The ... the full spectrum of electromagnetic radiation Source: http://www.mhhe.com/physsci/astronomy/arny/instructor/graphics/ch03/0305.html The Sun’s Radiation Spectrum Most of the sun’s radiation is...
- 44
- 1.4K
- 0