consequences of the calculations made with data of isotherms of type ii measured in a narrower domain of equilibrium relative pressure
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
... attack (15) The present clinical trial evaluated the safety and efficacy of UC -II in the treatment of the knee in OA patients Materials and Methods Study Design This clinical trial (Human Clinical ... used in Braham et al (1) To compare UC -II with G+C group, a linear contrast was included in the analysis of variance Data missing subsequent to 30 days were imputed using the last-observation-carried ... containing vitamins and minerals as the sole medicinal ingredients Use of concomitant prohibited medication (narcotics, oral NSAIDs, topical NSAIDs) within four weeks of randomization Use of acetaminophen...
- 10
- 706
- 0
Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt
... nucleated human cells in a total of 150 individual sections obtained from the basal, medial, and apical portions of the hearts Human engraftment Page of 13 in the heart, defined as the presence of ... detect a significantly better vascularization of the central infarct area in the ALDHhiLin- treated group as compared to the ALDHloLin- and PBS treated groups The fact that the ALDHloLin - cells also ... ALDHhiLin-transplanted animals (Figure 2) and in four of six ALDH lo Lin - transplanted animals (data not shown) The human engraftment in the ALDH hi Lin transplanted animals was generally more widespread...
- 13
- 506
- 0
Báo cáo lâm nghiệp: " Effects of site preparation with micro-basins on Pinus halepensis Mill. afforestations in a semiarid ombroclimate" potx
... is that of the rainfall values in the spring season, there is no correlation between the growth of the rings and the rainfall in any other season or the annual total Figure shows the relationship ... plot the presence of each species is marked with and its absence is marked with Combination in and of 2.4 Data analysis For the statistical comparison of data, mean values and dispersion measures ... individual tree from the base of the trunk to the apical eye was measured with a telescopic sight tapered in cm – Basal diameter of the stem was measured at ground level with a calliper tapered in...
- 8
- 288
- 0
Báo cáo y học: "Antibodies against the CB10 fragment of type II collagen in rheumatoid arthritis" pdf
... antibodies against bovine type II collagen (CII) and human CII Scatter plot of the levels of IgG antibodies against human CII and bovine CII in sera of patients with rheumatoid arthritis (RA; n = ... Mechanisms of disruption of the articular cartilage surface in inflammation Neutrophil elastase increases availability of collagen type II epitopes for binding with antibody on the surface of articular ... chromatogram and corresponding Coomassie blue protein stain (CII) illustrating the separation of the CB peptides of bovine CII with a linear salt gradient (dotted line) (b) Coomassie blue staining...
- 7
- 443
- 0
Báo cáo khoa học: "Ectopic pancreatic-type malignancy presenting in a Meckel''''s diverticulum: a case report and review of the literature" docx
... Histology and immunoprofile of pancreatic type adenocarcinoma Histology and immunoprofile of pancreatic type adenocarcinoma The malignant glands (arrows in A) are highlighted by cytokeratin expression ... serotonin and gastrin were negative These appearances are consistent with the tumour being a pancreatic -type adenocarcinoma arising from ectopic pancreatic tissue in a Meckel's diverticulum The patient ... when faced with a common gastrointestinal complaint and negative initial investigations When found incidentally at laparotomy or laparoscopy, it should be carefully examined for any gross macroscopic...
- 5
- 404
- 0
Báo cáo y học: "Signalling pathway involved in nitric oxide synthase type II activation in chondrocytes: synergistic effect of leptin with interleukin-1" pdf
... Cruz, CA, USA) The images of autoradiograms were captured and analyzed using a Typhoon 9410 digital variable mode imager (Amersham Biotech, Little Chalfont, UK) Data analysis Data are expressed as ... of NOS type II mRNA and protein In this modulation, an intracellular signalling pathway that involves JAK2 tyrosine kinase, PI3K and two members or the MAPK pathway (ERK and p38) is at play The ... superfamily A proinflammatory role for leptin has previously been proposed Several data show that leptin levels are increased by proinflammatory cytokine administration and in animal models of acute...
- 11
- 503
- 0
Báo cáo y học: " The effect of interleukin-13 (IL-13) and interferon-g (IFN-g) on expression of surfactant proteins in adult human alveolar type II cells in vitro" docx
... CGGGCAAGAAGCTGCTTCT CCACACCGCAGGGACAAACCCT CCACACCGCAGGGACAAACCCT SP-D ACACAGGCTGGTGGACAGTTG CCTCTCCACGCTCTGCCGCGT TGTTGCAAGGCGGCATT 36B4 CCACGCTGCTGAACATGCT AACATCTCCCCCTTCTCCTTTGGGCTT TCGAACACCTGCTGGATGAC ... http://respiratory-research.com/content/11/1/157 Authors’ contributions YI carried out all human and rat ATII cells studies YI and RJM participated in the design of the study and data analysis All authors have read and approved of the final ... reported increased amounts of SP -A in both bronchial and alveolar lavage and increased levels of SP-D in alveolar lavage fluid but not bronchial lavage fluid in patients with asthma [17] Cigarette...
- 13
- 256
- 0
The genetic basis of type 2 diabetes in a multi ethnic population in singapore
... Malay and Asian-Indian populations in Singapore We also examined their associations with traits that appear to be involved in the pathogenesis of type diabetes; namely obesity, insulin resistance ... sampling strategy and measurements SDCS comprises Chinese, Malay and Asian-Indian individuals with T2DM Since 2004, all individuals diagnosed with T2DM at primary care facilities of the Singapore ... loci As these initial studies were carried out in populations of European ancestry, the relevance of these genetic variants in Asian populations remain less well-characterized To gain a greater appreciation...
- 130
- 519
- 0
báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx
... Sequence Type X collagen Forward Reverse Forward Reverse 5'-AGTGCTGTCATTGATCTCATGGA-3' 5'-TCAGAGGAATAGAGACCATTGGATT-3' 5'-CGGCTACCACATCCAAGGAA-3' 5'-GCTGGAATTACCGCGGCT-3' 18S RNA film Molecular weights ... strain in the central region of the sponge was nearly constant This constant strain in the central region was consistently 1/2 of the overall strain values across a wide range of overall strain ... the strain in either end region Strain values are reported as mean ± one standard deviation RNA is constant in all the cells, the normalized value reflected the relative level of type X collagen...
- 10
- 546
- 0
Báo cáo y học: "Inhibition of macropinocytosis blocks antigen presentation of type II collagen in vitro and in vivo in HLA-DR1 transgenic mice" docx
... collagen, suggesting their involvement in uptake and resorption of collagen [49] However, no information was available on the capacity of other cell types to take up CII, as well as on the Available ... which the level of intracellular CII dropped, probably due to terminal lysosomal transport and degradation II collagen (CII) by macrophages The effect of inhibitors of uptake on the intracellular ... inhibitors of uptake Pretreatment of macrophages with cytochalasin D or amiloride reduced accumulation of CII in fractions and (Figure 4c) Monodansylcadaverine and filipin had no effect on CII internalization...
- 11
- 419
- 0
Báo cáo y học: " Atypical clinical presentation of mucopolysaccharidosis type II (Hunter syndrome): a case report" pptx
... proximal tapering of metacarpal Figure X-ray of the hands showing phalanges and metacarpals are widened with proximal tapering of metacarpals bones and tapering of the posterior ends of ribs (paddle ... depressed nasal bridge and a protuberant abdomen Page of mid-clavicular line, with a firm, sharp margin and a smooth surface with a span of 12 cm His spleen was cm below the left costal margin in the ... study and wrote the initial draft of the manuscript He acts as the guarantor TM and SS collected the data and drafted the paper GSS helped in the acquisition of significant intellectual content and...
- 4
- 315
- 1
Báo cáo y học: "A multicenter, double-blind, randomized, controlled phase III clinical trial of chicken type II collagen in rheumatoid arthritis" ppsx
... models, including arthritis CII is the most abundant structural protein of human cartilage The cartilage within the joint caused mainly damage of autoimmunity in patients with RA CII autoimmunity may ... be a secondary phenomenon induced following inflammation in the joints and may play a role in the persistence of the disease rather than in actual induction of arthritis [25,26] In either case, ... pauciarticular-onset and systemic-onset RA patients [10] These data support the view that autoimmunity to an antigen such as CII in cartilage plays a major role in the pathogenesis of RA In animal...
- 10
- 356
- 0
Báo cáo khoa học: "Combining POMDPs trained with User Simulations and Rule-based Dialogue Management in a Spoken Dialogue System" docx
... various levels of description in a uniform way This facilitates dialog evaluation, data mining and online learning because data is available for querying as soon as it has been stored There is no ... resulting in the generation of an appropriate request The visualization of the internal representation of the POMDP-DM includes the N best dialogue states after each user utterance and the reranking ... policies These policies are obtained by dialogue simulations with user models based on data obtained from humanmachine dialogues with the original rule-based dialogue manager The web tool is available...
- 4
- 269
- 0
Báo cáo hóa học: " Patients with chronic fatigue syndrome performed worse than controls in a controlled repeated exercise study despite a normal oxidative phosphorylation capacity" pdf
... and the remaining complexes of the respiratory chain maintain the mitochondrial membrane potential [35] Their mitochondria are only active in apoptosis [36] In line with the present work, Mathew ... synthase (CS) activity according to Srere [23] and protein concentration by the Bio-Rad DC protein assay (Bio-Rad Laboratories) with bovine serum albumine as a standard The ATP synthesis rate was expressed ... tests The amount of the mitochondria of PBMC was estimated by the assay of citrate synthase, and the activity was not different Data are presented as mean ± SD *.Statistically significant difference...
- 7
- 387
- 0
– GED LITERATURE AND THE ARTS, READING PRACTICE QUESTIONS – 61. d. It is ironic that in a place pdf
... representing the vertical placement Coordinate points are given in the form of (x,y) Surface Area The surface area of an object measures the area of each of its faces The total surface area of a rectangular ... diagonals in the polygon above are line segments BF and AE A regular polygon has sides and angles that are all equal An equiangular polygon has angles that are all equal Angles of a Quadrilateral ... tested, guidelines for the use of calculators, and recent changes in the test What to Expect on the GED Mathematics Exam The GED Mathematics Exam measures your understanding of the mathematical knowledge...
- 48
- 435
- 0
Báo cáo khoa học: " Late treatment with imatinib mesylate ameliorates radiation-induced lung fibrosis in a mouse model" docx
... attenuation of the acute inflammation is necessary to block fibrosis and iii) if a late drug administration after radiation insult and after the acute inflammation has subside still has antifibrotic ... by intratracheal instillation of 4% formalin, followed by overnight fixation, embedding in paraffin, sectioned at μm, and stained with hematoxylin-eosin (H&E) The total count of Page of (page ... competing interests 14 Authors' contributions ML performed experiments, analyzed data and participated in writing the manuscript AA participated in designing the study and analyzed data KEL participated...
- 9
- 287
- 0
báo cáo khoa học: " Ovarian cryopreservation after laparoscopic ovariectomy using the Endo-GIA stapling device and LAPRO-clip absorbable ligating clip in a woman: a case report" ppt
... impact of electrocoagulatory ovarian tissue damage on the outcome of ovarian tissue harvesting and reimplantation Further studies should assess ovarian tissue damage and the results of ovarian ... ovary [4] Furthermore, some data suggest that bipolar electrocoagulation of the ovarian parenchyma during laparoscopic ovarian cystectomy adversely affects ovarian function [5,6] These data show possible ... JL and AM performed the ovarian cryopreservation and were major contributors in writing the manuscript All authors read and approved the final manuscript Competing interests The authors declare...
- 3
- 203
- 0
Báo cáo y học: "Spondylarthritis presenting with an allergic immediate systemic reaction to adalimumab in a woman: a case report" pptx
... 18 cm An X-ray and a magnetic resonance imaging scan showed sacroiliitis A diagnosis of spondylarthritis was made The patient was started on therapy with sulfasalazine g/day and deflazacort 7.5 ... Phadia, Uppsala, Sweden in collaboration with our Laboratory of Immunology and Allergy, was used to assay serumspecific IgE to adalimumab A commercial Phadia ImmunoCAP was used for the assay of ... in cases of repeated exposure to large quantities of antigen [15] It could be speculated that a similar mechanism was underlying the reactions of our patient With the aim of ascertaining whether...
- 4
- 363
- 0
Báo cáo y học: "Intramuscular myxoma associated with an increased carbohydrate antigen 19.9 level in a woman: a case report" pptx
... are associated with fibrous dysplasia of the bones of the same extremity, known as Mazabraud syndrome [6,7] The vast majority of patients are asymptomatic, and the myxoma appears as a painless, ... reveals a mass of low attenuation (less than that of the muscle), with almost equal appearance of homo- and heterogeneous texture [4] After the administration of intravenous contrast, CT images ... was lobulate with dimensions 78×59×45 mm and relatively well-defined margins No enhancement was marked after the intravenous administration of paramagnetic substance (Figures and 2) Additional...
- 4
- 385
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu