... CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides on the PMV cDNA are ... P31 7A- 989R N32 3A- 1007R L32 5A- 1014R REP/Y -A 1044R-C /A REP/F -A REP/D -A MUTPMV-1236R REP/W -A CCCCAGCGGCTTCGTTCTTTGC GGAACCCCAGCAAACTCGTTCTTTGC CTGTGGGTTTTGCAACCCCAGCG CAGCCAACTGGGCAGCCTCTGTG CTCCAGACAGCCGCCTGGTTAGC ... peroxidase (Amersham Pharmacia Biotech, Piscataway, NJ) was used at a 1:5,000 dilution and assayed by enzymatic reactions The remaining half of the extract was prepared for RNA blots, as described...
... communications networks demand a migration platform equipped with the cable management and physical rearrangement flexibility to accommodate new services and network elements Today’s networks demand the ... errors or to another network element to temporarily reroute the signal The integration of a DSX into the network allows operators to patch around faulty circuits quickly and easily And operators are ... important corporate asset and vigorously enforces its patents Products orfeatures contained herein may be covered by one ormore U.S or foreign patents An Equal Opportunity Employer 101819AE...
... www.troytec.com Availability - The percentage of time that the network infrastructure is up and running and available for use • Analyze data and system access patterns Assess the peaks and valleys that exist ... single network infrastructure Several offices have small networks, but these networks not connect each other orwith the central hospital network Other offices have one ormore stand-alone computers ... interoperable, and manageable Client computer configuration on the network should be automatic and fault tolerant All network services must be completely fault tolerant and available at all times For...
... economy Today, with marketing more International Journal of Marketing Studies May, 2009 integrated into organisations and witha wider variety of products and markets, some authors have attempted ... doubts as to the role of the Mix as marketing management tool in its original form, proposing alternative approaches, which is adding new parameters to the original Mix or replacing it with alternative ... services marketing area (Rafiq and Ahmed, 1995) The introductory marketing texts suggest that all parts of the marketing mix (4Ps) are equally important, since a deficiency in any one can mean failure...
... Situation, Table A- 12 (march 2010) This rate is seasonally adjusted U.s Department of Labor, Bureau of Labor statistics, Historical Data, Table A- 12 21 U.s Department of Labor, Bureau of Labor ... unemployment rate higher than 10 percent, and six states (California, florida, michigan, nevada, rhode island, and south Carolina) had a rate of at least 12 percent.14 | A YEAR OR MORE: The high CosT ... national average for all workers.26 of all older workers, both employed and unemployed, only 2.1 percent have been out of work for a year or longer, also below the national average for all workers.27...
... Immunoprecipitation and SDS/PAGE Materials and cell lines The mAbs V.1 and V.5 against GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19] ... mass forms Parallel analysis of the supernatants revealed a positive signal starting at 60 of chase and having a molecular mass (82 kDa) consistent witha fully mature form This band was not ... of fluorescein isothiocyanate-(FITC)-conjugated goat anti-(rat IgG) F(ab¢)2 or FITC-conjugated goat anti-(mouse IgG) IgG (Jackson Immunoresearch, West Baltimore, PA, USA) for 30 at °C Analyses...
... Makes You More Social! Apps can also make your social media campaign more effective By linking mobile apps to social networking sites, you increase their social sharing potential, thus increasing ... are also a great way to advertise or talk about promotional campaigns and special announcements and send across the message to your target customers For instance, if a business is announcing a ... becoming more powerful than social media as a marketing and engagement tool Find out How! Chapter 2: Have A Business, Build An App Learn how and why your local business needs an interactive and engaging...
... ice that may affect balance.)" Participants, who reported a fall, were then asked to report the number of falls in the past year Data Analysis Prior to data analyses the gait variability data were ... Journal of NeuroEngineering and Rehabilitation 2005, 2:21 Background Variability of gait can be quantified using both temporal and spatial gait characteristics Variability of temporal characteristics ... were examined for normality The gait variability data were relatively normally distributed (mean values approximately equal to median, low values for skewness and kurtosis) For step width variability...
... formation (1) and bridging or lamellar bone formation (2) An assessment of these results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical ... radiographs or histologically Bone absorption and formation on the graft were assessed with plain radiographs When the bone was absorbed within the cortex, the result was classified as mild absorption, ... radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant...
... interference: analog network coding in Proceedings of the ACM SIGCOMM, 397–408 (2007) 11 R Zhang, YC Liang, CC Chai, S Cui, Optimal beamforming for two- way multi-antenna relay channel with analogue network ... performance of an outage-optimal opportunistic scheduling scheme with fairness for a multi-pair ANC-based two- way relay network over a Appendix I Proof of Theorem We can express Pr[min( a, k , ... opportunistic scheduling with analog network coding in multiuser two- way relay networks EURASIP Journal on Wireless Communications and Networking 2011 2011:194 Submit your manuscript to a journal...
... Harjani, J, Lopez, B, Sadarangani, K: A fixed point theorem for mappings satisfying a contractive condition of rational type of partially ordered metric space Abstr Appl Anal 2010, (2010) (Article ... equality defining a circle Aa1 for a fixed a1 = a1 (x0, y0) ≤ a- a’ is defined below together with available point-dependent lower and upperbounds: De la Sen and Agarwal Fixed Point Theory and Applications ... 0 a (1 − α1 ) > − α1 and ® A ∪ Awith >a ≥ 0, β1 = a0 a ≥ a1 ≥ a − A1 ∪ A2 a β1 = > It is noted that the condition (3.1) is not guarana0 − α1 teed to be contractive for any point of A1 It is also...
... study and surface characterizations using FE-SEM and participated in draft writing SJS conducted practical MNHS fabrication, surface wettability characterizations, and graphical information creation ... remove organic materials This was followed by an additional cleaning process with acetone and methanol for each in turn, using a sonicator For fabricating SiNWs by electroless etching, the wafer was ... boiling Table Contact angle (θ) measurements for the MNHS Figurea PR removal Pillar Asher Pillar Acetone Cavity Asher Cavity a Micro-pattern Contact angle Acetone SEM images displayed not match practical...
... develop a novel algorithm to combine particle filters with neural networks The strategy of backpropagation neural networks can be used to adjust particles in tail area with low weights in a particle ... data of a neural network Their corresponding weights are set as inputs of the neural network, and their particle values as initial weights of the neural network The weights of the remaining particles ... all related parameters automatically based on available seizure information From Figure 1, the hidden variable’s value at certain time before seizure occurrence reaches a peak Before that peak,...
... needle area was measured witha leaf area meter (Delta-T Devices, Cambridge, UK) Once Ψwp had reached a threshold of around –2 MPa (after approx 10 days), saplings were watered to field capacity and ... unlabelled C that would be less easily accessed In fact, one has to take into account that storage compounds were probably not uniformly labeled, and that recently stored (and also more readily ... readily available compounds) were probably more labeled than what was measured from bulk products This can be particularly true for C mobilization from starch granules that display a layered structure...
... Hospital, Lu-Tung Branch, Changhua, Taiwan 8Wei Gong Memorial Hospital, Miaoli, Taiwan 9Cathay General Hospital, Taipei, Taiwan 10Catholic Mercy Hospital, Hsinchu, Taiwan Authors’ contributions All ... General Hospital and University, Hualien, Taiwan National Cheng Kung University Hospital, Tainan, Taiwan 6National Taiwan University Hospital, Yun-Lin Branch, Yun-Lin, Taiwan 7Changhua Christian ... of AEs, serious AEs (SAEs); discontinuation due to AEs, abnormal laboratory results, physical examination, vital signs, body mass index (BMI), waist/hip measurement and metabolic syndrome parameters...
... Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi M: S-1 plus cisplatin versus S-1 alone for first-line ... Fukushima M, Satake H, Uchida J, Shimamoto Y, Kato T, Takechi T, Okabe H, Fujioka A, Nakano K, Ohshimo H, Takeda S, Shirasaka T: Preclinical antitumor efficacy of S-1: a new oral formulation of ... combination therapy with S-1 and docetaxel (TXT) for advanced or recurrent gastric cancer Anticancer Res 2004, 24:1843-1851 Yoshida K, Ninomiya M, Takakura N, Hirabayashi N, Takiyama W, Sato Y,...