common and proper nouns worksheets for grade 4
LISTENING DIFFICULTIES PERCEIVED BY TEACHERS AND STUDENTS IN USING THE NEW ENGLISH TEXTBOOK FOR GRADE 10 AT QUE VO II UPPER SECONDARY SCHOOL IN BAC NINH
... 56% 44 % Order the series of pictures or events 33% 45 % 22% True/false 100% Do extra-listening tasks 18% 56% 24% Play games related to listening 32% 44 % 24% ... makes up 47 %, a compulsory subject 29% and job opportunities in the future 100%. Meanwhile, improving listening ability to understand and communicate in real situations and listening for entertainment ... grasp the strategies and skills students need. 44 and activities is spite of many obstacles like poor learning condition, lack of listening experience and strategies and so on. Apart...
- 53
- 1,232
- 7
Tài liệu Báo cáo khoa học: "A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora" doc
... points are used for compiling a secondary lexicon. 6. Compute a position binary vector for each word using the anchor points. The re- maining nouns and proper nouns in English and all words ... = 20, 27, 41 , 47 ,193,321,360. The Chinese trans- lation for prosperity is ~!. Its position vec- tor is (1955,5050, ,88 048 ). Its binary vector is V2[i] = 1 where i = 14, 29, 41 , 47 ,193,275,321,360. ... these two vectors share five segments in common. We compute the segment vector for all English nouns and proper nouns not found in the first lex- icon and whose frequency is above two. Words...
- 8
- 426
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... medium(nmolặs)1ặmg)1)1/750 1.5 5 .4 His _44 /750 ND 4. 1 44 /750 6.7 27.7 44 /750_V5-His <0.001 0.002 44 /735 <0.001 <0.001 44 /716 <0.001 <0.001 44 /587 <0.001 <0.00159/750 0.003 4. 090/750 <0.001 ... kcat/Km(lM)1ặs)1) 44 /750 (rhGCPII) 5 .4 0.3 160 44 33.7 ± 15 .4 1/750 8.5 ± 0 .4 472 ± 88 18.1 ± 5.1His _44 /750 0.80 ± 0.05 127 ± 47 6.6 ± 4. 059/750 1.00 ± 0. 04 81 ± 11 12.7 ± 2.2Ó FEBS 20 04 Domain structure ... 1 min/ 94 °C; 1 min/ 54 °C; 4 min/72 °CATTCTCGAGTCATTAGGCTACTTCACTCAAAG 44 /735 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/ 94 °C; 1 min/ 54 °C; 4 min/72 °CATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT 44 /716...
- 9
- 414
- 0
Báo cáo khoa học: "Example-Based Metonymy Recognition for Proper Nouns" pot
... names,Markert and Nissim distinguished betweenplace -for- people, place -for- event and place -for- product. For the organi-zation names, the most frequent metonymiesare organization -for- members and organization -for- product. ... identical to Nissim and Mark-ert’s figure, and precision, recall and F-score for the metonymical class lie only slightly lower.3TiMBL’s results for the Hungary data were simi-lar, and equally comparable ... organization -for- members and organization -for- product. In addition,Markert and Nissim used a label mixed for examples that had two readings, and othermet for examples that did not belong to any...
- 8
- 374
- 0
báo cáo hóa học: " Time and frequency domain methods for quantifying common modulation of motor unit firing patterns" pot
... and discussionFigure 4a,4b,4c displays the regression between the lowfrequency time domain common drive coefficients for Hanning windows of length 200, 40 0 and 800 ms and peak low frequency ... best suited.Published: 14 October 20 04 Journal of NeuroEngineering and Rehabilitation 20 04, 1:2 doi:10.1186/1 743 -0003-1-2Received: 30 August 20 04 Accepted: 14 October 20 04 This article is available ... discharge properties and force tremor. Exp RBraines 1995,1 04: 115-125.19. Adam A, De Luca CJ, Erim Z: Hand dominance and motor unitfiring behavior. J Neurophysiol 1998, 80:1373-1382.20. Garland...
- 12
- 479
- 0
The Case of the Missing Market: The Bond Market and Why It Matters for Financial Development
... 10,382 14, 686 25,068 40 .9%1992 12,189 18,3 64 30,553 21.9%1993 15,302 22,6 34 37,936 24. 2%19 94 20,153 28,999 49 ,152 29.6%1995 25,155 41 ,011 66,166 34. 6%1996 36,172 37,559 73,731 11 .4% 1997 34, 855 ... GCF)Outstanding(% GDP)Net Issues(% GCF)Hong Kong, China162 .4 70.8 244 .8N/A0.60.0Indonesia55 .4 31.9 34. 88.0N/AN/AKorea65.729.533.5 4. 017 .4 10.9Malaysia93.1 43 .9269.2 14. 023.318.9Philippines 49 .068.5 84. 88.00.00.0Singapore97.336.1161.6N/A2.70.0Taipei,China 142 .235.8 84. 7N/AN/AN/AThailand100.031.365.86.03.9∗1.9Average ... overLiabilities(%)Leverage1997:Q4 1 .49 32.0 36 .4 7.3 2.951997:Q3 2.59 23.3 30.8 10.2 2.951997:Q2 3.18 19.9 18 .4 NA 2.121997:Q1 3.66 15.3 16.2 NA 2.011996:Q4 3.11 13.8 11.8 14. 9 1.901995:Q4 4. 01 9.6 7.6 18.1 1.6719 94: Q4...
- 43
- 828
- 0
TYPHOONS AND TECHNICAL SOLUTIONS RECOMMENDED FOR EXISTING AND NEW HOUSES IN THE CYCLONIC REGIONS IN VIETNAM
... foam and spray. Sea completely white with driving spray. Land conditions: Visibility very greatly reduced. Massive and widespread damage to structures. 13 14 > 14 1 34- 149 ( 84- 93) ... poetry. Crown, ISBN 140 0 048 842 , 20 04. [7] Nguyen Xuan Chinh, Nguyen Huu Hung and others Investigations on the damages of houses and buildings caused by typhoons Xangsane and Durian, Internal ... ( 84- 93) 150-166 ( 94- 103) > 167 (1 04) Very strong typhoon / 87-107 (zone IIB) Super typhoon 108-133 (zone IIIB) Super typhoon In 1 944 , it was extended to scale 13- 14 for the typhoon...
- 12
- 584
- 0
Aptitude Test for grade 12
... Ordinal C. Cardinal D. Statistical 34. A. pronounced B. uttered C. claimed D. emitted35. A. pointed B. evolved C. planned D. showed36. A. forming B. formulating C. performing D. burdening37. A. prepare ... _______________ (precise). 14. Unfortunately, I do not have the information because our records are _______________ (complete).15. If the exercise causes _______________ (comfortable), stop immediately.16. ... cleaning, washing, and ironing, according to theSocial Trends Survey by the Central (33)_____ Office.Nearly three quarters of married women ( 34) _____ to do all or most of the housework, and among married...
- 3
- 1,278
- 5
Written test for grade 10 (term I)
... it, say so.They are looking forward to hearing your compliments. Of course, you will thank them for themeal and for their kindness. It is also a good idea to send a (40 ) ______note the day after. ... year: 2008-2009 *0* Key for first term test (grade 10) (40 X 0.25 = 10 Points)Câu I Câu IV: 1. D2. A3. C 4. D5. C6. B7. D8. C9. B10. B11. D12. A13. C 14. A15. A16. B17. C18. ... looking forward to hearing your compliments. Of course,you will thank them for the meal and for their kindness. It is also a good idea to send athank you note the day after. The end- 4 - Đáp...
- 14
- 1,843
- 12
Word form for grade 9
... qualified teachers. (good) 24- We need further ___________________ (inform)25- This book is very ________________ (inform)26- Look at the ___________________. Rain Bi looks handsome. (advertise)27- ... ___________________ for teenagers. It’s ________________ (use) 40 - Their ___________________ is always good. (communicate) 41 - She is a ________________ girl. (communicate) 42 - Listen ___________________ ... ___________________ please. (care) 43 - We’re ___________________ that our environment is spoiled. (disappoint) 44 - Our boys play ________________ today. (disappoint) 45 - We’re worried about the ___________________...
- 4
- 3,723
- 146
1st English TEST for grade 10
... petrol attendant, a barman, and an undertaker. Also, I and my wife, Margaret, have a shop and a small hotel.I live and work on the island of Gigha in the west of Scotland. Only 20 people live ... 6.00 and makes breakfast for the hotel guests. At 8.00 I drive the island's children to school. At 9.00 I collect the post from the boat and deliver it to all the houses on the island. ... Exercise 5: Read the passage below and choose one correct answer for each question.(2m)My name is Seumas McSporran and I'm a very busy man. I'm 60 years old and I am a postman, a politician,...
- 2
- 2,266
- 12
Test for grade 12
... Jeans and T-shirt.A. typical B. comfortable C. cheerful D. interesting 14. We got on the plane and waited about 10 minutes before it ____________.A. landed B. took off C. take off D. land15. ... Jeans and T-shirt.A. cheerful B. interesting C. comfortable D. typical29. We got on the plane and waited about 10 minutes before it ____________.A. take off B. took off C. land D. landed30. ... her to wear Jeans and T-shirt.A. typical B. interesting C. cheerful D. comfortable 20. We got on the plane and waited about 10 minutes before it ____________.A. landed B. land C. take off D....
- 14
- 840
- 2
English department to test for grade 6
... bedrooms and a bath room. Outside, there’s agarage, a front garden, and a back garden. The house isn’t very big but we like it. It’s convenient for shops and school and things like that, and ... 182 Test 2 183 Test 3 183 Listening script 183 UNIT 11 183 Test 1 1 84 Test 2 1 84 Test 3 1 84 Listening script 1 84 Answers : 185 UNIT 12 185 Test 1 185 Test 2 185 Test 3 186 Listening ... Which sentence is correct? A. How’s about going for a walk? B. What’s about going for a walk? C. What you say we go for a walk? D. Why don’t we go for a walk? 8. Which word contains a different...
- 194
- 1,324
- 3
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25