colour style and weight of a line or exterior border and to set a dashed effect if desired connectors can be changed between straight elbowed and curved types and any line can be converted to an arrow or vice versa
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
... Nakano K, Okada Y, Saito K, Tanaka Y: Induction of RANKL expression and osteoclast maturation by the binding of fibroblast growth factor to heparan sulfate proteoglycan on rheumatoid synovial ... nodules of bone formation (1) and bridging or lamellar bone formation (2) An assessment of these results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining ... terms of bone incorporation and bone absorption Materials and methods Animals Nine-week-old male Wistar rats (Kyudo Co Ltd., Saga, Japan), ranging in weight from 300 g to 350 g, were used The rats...
- 10
- 478
- 0
Sequential effects of a high fat, calorie dense diet or a high fiber diet on gene expression, body weight and associated metabolic responses in c57 BL6J mice
... Organization, 2002) The pandemic of cardiovascular disease, diabetes and obesity can be viewed as a mismatch between our present environmental circumstances (e.g an excessive calorie and fat intake ... provides a mechanism for physiological regulation of betaoxidation in all mammalian tissues and for cellular fuel sensing based on the availability of fatty acids (McGarry and Brown, 1997; Prentki and ... separately obtained data sets cannot readily be compared, which is in contrast to SAGE and microarray data With SAGE, ‘tags’ – pieces of approximately 12 base pairs of cDNA - are first generated...
- 228
- 231
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... and w and were subsequently refined by varying /, w angles in intervals of 10° and setting h angle to ) 60 ± 10° and 60 ± 10° Each /, h, and w-value was fixed by applying a harmonic potential and ... CSDHa and CSDCa variations demonstrate the formation of more stable and abundant helical structures for [Aib9]SP than for SP By restrained molecular dynamics, [Aib9]SP has been shown to adopt a ... values for the cAMP pathway and for the inositol phosphates pathway SP, [Ala9]SP and [Pro9]SP are almost equipotent at the major binding site NK-1M (Ki between 0.64 nM and 1.6 nM and EC50 values between...
- 11
- 860
- 0
the chemical laboratory its design and operation a practical guide for planners of industrial, medical, or educational facilities
... Medical, and Research Laboratories Educational Laboratories Reagent Storage Glassware Instruments Preparation Space Repair and Maintenance Equipment Check-Out Laboratory Location Safety Considerations ... charge, a fIXed monthly charge, and a separate charge each time a tank is changed The service company will make an estimate as to what size tank or tanks a laboratory needs The use of two tanks ... This can be located between two laboratories, giving it better accessability SAMPLE RECEIVING Analytical laboratories need an area where incoming samples can be sorted and recorded The size of...
- 173
- 561
- 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
... and genotypes of GII NoV was obtained from external laboratories (Table 2) This stool panel was applied to the Lightcycler assay and all the genotypes were detectable Detection and quantification ... TGC TYG A TTC CCC TGG AGA AGT ACT CCT CGA ACT AAA TCC ATA CCT AGC ACAC CAG TGG CGG GAC AAA CCA AC CTC TCC TGG AGA ACT CCT ACT TGA T GAA GTC TTG CCT TTA GAG CCC GTC CAG TTG CGG GAG CTT CAA TCG CT ... 10 µl of extracted RNA and µl of 75 pmole random hexamers (Roche) are added to a 0.5 ml PCR reaction tube, mixed and heated to 95°C for A master-mix was prepared according to the manufacturer's...
- 8
- 535
- 1
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt
... and genotypes of GII NoV was obtained from external laboratories (Table 2) This stool panel was applied to the Lightcycler assay and all the genotypes were detectable Detection and quantification ... TGC TYG A TTC CCC TGG AGA AGT ACT CCT CGA ACT AAA TCC ATA CCT AGC ACAC CAG TGG CGG GAC AAA CCA AC CTC TCC TGG AGA ACT CCT ACT TGA T GAA GTC TTG CCT TTA GAG CCC GTC CAG TTG CGG GAG CTT CAA TCG CT ... 10 µl of extracted RNA and µl of 75 pmole random hexamers (Roche) are added to a 0.5 ml PCR reaction tube, mixed and heated to 95°C for A master-mix was prepared according to the manufacturer's...
- 8
- 502
- 0
báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line paediatric antiretroviral access and use in Asia and southern Africa" pot
... Kelantan, Malaysia; K Razali* and NF Abdul Rahman, Pediatric Institute, Hospital Kuala Lumpur, Kuala Lumpur, Malaysia; R Nallusamy* and KC Chan, Penang Hospital, Penang, Malaysia; V Sirisanthana *and ... Sirisanthana *and L Aurpibul, Chiang Mai University, Chiang Mai, Thailand; R Hansudewechakul* and A Khongponoi, Chiangrai Prachanukroh Hospital, Chiang Rai, Thailand; P Lumbiganon* and P Kosalaraksa., ... Kaen University, Khon Kaen, Thailand; G Jourdain, Program for HIV Prevention and Treatment, Chiang Mai, Thailand; J Ananworanich*† and T Suwanlerk, The Netherlands, Australia, Thailand Research...
- 8
- 364
- 0
báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line pediatric antiretroviral access and use in Asia and southern Africa" pdf
... Epidemiologic Databases to Evaluate AIDS (IeDEA) Southern Africa Paediatric Group: A biregional survey and review of first -line treatment failure and second -line paediatric antiretroviral access and use ... pediatric antiretroviral access and use in Asia and southern Africa Journal of the International AIDS Society 2011 14:17 Submit your next manuscript to BioMed Central and take full advantage of: ... Thailand d4T or AZT+3TC+NVP or EFV ddI+ABC or 3TC+PI/r AZT+3TC+LPV/r Chiang Rai Regional Hospital Thailand d4T or AZT+3TC+NVP or EFV ddI+ABC or 3TC+PI/r AZT+3TC+LPV/r HIV-NAT Thailand d4T or AZT+3TC+NVP...
- 3
- 343
- 0
Báo cáo y học: "Predicting hospital admission and discharge with symptom or function scores in patients with schizophrenia: pooled analysis of a clinical trial extension" doc
... of the open-label phase The two categorical PSP and PANSS variables and the indicator of whether the patient was at a US or non-US site were significant in both of the two hospitalization models ... schizophrenia morbidity can be decreased and the direct and indirect costs of these diseases can potentially be lowered Such assessment tools might give clinicians a better understanding of the impact of ... http://www.annals-general-psychiatry.com/content/9/1/24 cator variables were created for the PSP and PANSS categories, with the reference categories being PSP ≥ 71 and PANSS < 75 The PSP or PANSS score measured at the assessment prior to the...
- 8
- 425
- 0
Báo cáo y học: "SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis" docx
... GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG SRPX TGGCTGGTTGATTTTGTAGAGAAA TAGAAAAGAGTTAGGTGTCACATTGAATAA SPINT1 CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT ... GTGAAACTGAGTTTTGTATAACCTCTCAGT CRLF1 AACGGCCATAACAGCTCTGACT ACTCAACCAACCCTCACACACA MYBPH AGGCCTACAGTCAAACTCCAGAGA GAAGGGAGGCCAGCAGGTA Page of 10 (page number not for citation purposes) Arthritis Research & ... All authors read and approved the final manuscript Acknowledgements The authors wish to thank Andrew Hayes and Leo Zeef for technical and analytical assistance with the microarray study and to...
- 10
- 387
- 0
Báo cáo y học: " Histology of adipose tissue inflammation in Dercum’s disease, obesity and normal weight controls: a case control study" doc
... demonstrated an inflammatory reaction (I-III) with lymphocytes and macrophages (Figures 1, Page of and 3) An inflammatory reaction judged as I can be seen in Figures and and II in Figure In the obese ... autoimmune disease Case reports have shown that markers for autoimmune disease, such as rheumatoid factor (RF), antinuclear antibodies (ANA), anticardiolipin antibodies (ACA), perinuclear anti-neutrophil ... Declaration of 1964 Statistics Values are given as medians and ranges Histograms were drawn to examine the distribution of the measured factors The histograms indicated that the measured factors...
- 6
- 403
- 0
Histology of adipose tissue inflammation in Dercum’s disease, obesity and normal weight controls: a case control study pdf
... demonstrated an inflammatory reaction (I-III) with lymphocytes and macrophages (Figures 1, Page of and 3) An inflammatory reaction judged as I can be seen in Figures and and II in Figure In the obese ... autoimmune disease Case reports have shown that markers for autoimmune disease, such as rheumatoid factor (RF), antinuclear antibodies (ANA), anticardiolipin antibodies (ACA), perinuclear anti-neutrophil ... Declaration of 1964 Statistics Values are given as medians and ranges Histograms were drawn to examine the distribution of the measured factors The histograms indicated that the measured factors...
- 6
- 268
- 0
Báo cáo y học: " Disrupting the rhythm of depression: design and protocol of a randomized controlled trial on preventing relapse using brief cognitive therapy with or without antidepressants" pptx
... second For an overview of the assessments at baseline, in between- and post treatment and follow up assessments see table Withdrawal Participants can withdraw from treatment or from the study at any ... [31]) They ask participants to describe past and current treatments for depression, their attribution of relapse and recurrence and use of AD If participants meet all inclusion and none of the exclusion ... hypomania or a history of bipolar illness, any psychotic disorder (current and previous), organic brain damage, alcohol or drug dependency/abuse, predominant anxiety disorder In the treatment arms...
- 9
- 350
- 0
Báo cáo y học: " Skill execution and sleep deprivation: effects of acute caffeine or creatine supplementation - a randomized placebo-controlled trial" potx
... using a two-way analysis of variance (ANOVA) with repeated measures on both the dominant and non-dominant passing sides A two-way repeated measures ANOVA was also used to evaluate the effects of ... SD and BC participated in protocol design, data analyses and manuscript preparation All authors have read and approved the final manuscript Competing interests The authors declare that they have ... sleep state, treatments and any interactions for each hormonal variable In addition, dominant versus non-dominant side skill performance during familiarisation trials and non-deprived performance...
- 8
- 275
- 0
Báo cáo y học: " Dual role of TRBP in HIV replication and RNA interference: viral diversion of a cellular pathway or evasion from antiviral immunity?" potx
... work done in our laboratory is/was supported by the Canadian Institutes of Health Research, the Canadian Foundation for AIDS Research, the Canadian Foundation for Innovation and the Fond de la ... shared by plant and insect silencing suppressors This characteristic suggests a link or an overlap between the mechanism of RNAi and the PKR pathway in mammalian cells One common feature is that ... specificity of action [10] Adenovirus VA RNAI and VA RNAII are cleaved by Dicer and act as RNAi suppressors [13] Both Tat protein and VA RNAs inhibit Dicer activity A striking feature of RNAi suppressors...
- 6
- 242
- 0
Báo cáo y học: "Establishment of a novel CCR5 and CXCR4 expressing line which is highly sensitive to HIV and suitable for high-throughput evaluation of CCR5 and CXCR4 antagonists" pdf
... NA 18 NA 3.6 3.3 NA >1000 >1000 a Effect of AMD3100 and SCH-C and the chemokines SDF-1, RANTES and LD78β on the replication of laboratory HIV-1 strains BaL, NL4.3 and HE Virus yield was monitored ... rheumatoid arthritis [7,8]., allergic airway disease [9], and cancer [10-12] Important ligands for CCR5 are the βchemokines 'regulated on activation normal T cell expressed and secreted' (RANTES), ... Ag ELISA assays EDC critically evaluated the manuscript DS participated in the design of the study and coordinated it All authors read and approved the final manuscript Acknowledgments We thank...
- 13
- 395
- 0
The construction and implementation of a dedicated beam line facility for ion beam bioimaging
... CIBA beam parameters and beam optics parameters required for probe size calculation 52 Table 3-5 Scanning voltage calculation for typical beam energy and scan size Calculation is based ... profile data are extracted from the two rectangular areas for beam spot size analysis in horizontal and vertical directions 83 Figure 3.20 Shape of the line scan in scanning a Gaussian ... been mainly used for broad beam analysis to determine sample stoichiometry and elemental 25 depth distributions In scanning microbeam applications, RBS can be used as an important technique to determine...
- 183
- 279
- 0
Development and characterization of a SARS coronavirus replicon cell line
... of America, and beyond to a total of 30 countries and areas of the world (World Health Organization, 2003d) The incubation period of SARS ranges from to 16 days Large studies demonstrated a median ... has been identified to be angiotensin-converting enzyme (ACE2) (Li et al., 200 3a) Furthermore, syncytia formation/membrane fusion and viral replication can be specifically inhibited by an anti-ACE-2 ... et al., 200 3a; Marra et al., 2003; Rota et al., 2003) and are believed to encode as many as 28 separate proteins Figure SARS-CoV genome organization and expression The putative functional ORFs...
- 103
- 347
- 0
Effects and mechanisms of a concentrated goyasaponin fraction in 3t3 l1 cell line
... the effects and relevant mechanisms of M Charantia on anti-obesity and type diabetes prevention and/ or management 5.2 Overall Objectives M charantia is widely used as a traditional functional ... systems of many cultures worldwide, including those of the Asian Indians, Chinese and South Americans [79] Besides anti-diabetic properties, M charantia has also been credited with antiviral, antitumor, ... of traditional functional foods, such as plants and herbal remedies to treat disease and symptoms has a long history of use in Asia and other developing countries [77, 78] Momordica charantia is...
- 89
- 271
- 0
The Design and Implementation of a Log-Structured File System
... than performance There are two components of disk performance: transfer bandwidth and access time Although both of these factors are improving, the rate of improvement is much slower than for ... mean that new data could be written at the full disk bandwidth and there is no cleaning overhead A write cost of 10 means that only one-tenth of the disk’s maximum bandwidth is actually used for ... reflect actual file system usage patterns (its model is much harsher than reality), but it helped us to understand the effects of random access patterns and locality, both of which can be exploited to...
- 15
- 1,434
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008