collecting a wound culture
A cross culture study on using gestures of vietnamese and american people
... the American’s space The American, naturally, takes a step backward The Vietnamese wants to show his friendliness, so steps forward again, the American steps backward…again and again, create ... body language acts and they are used by just about everyone For instance, someone who brushes their hand against another’s forearm may be seen as communicating an act of attraction Touch as an act ... within families, and also across age and gender lines Sometimes, hugs are a romantic exchange Hugs may also be exchanged as a sign of support and comfort A hug demonstration emotional of can be affection...
- 76
- 1,354
- 10
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... which are not asked, and also contain practical examples Human-powered answers often contain unrelated information and discourselike elements Additionally, the answers not always have a connection ... $0.01 Amazon.com collects a 10% (or a minimum of $0.05) service fee per each paid reward • Qualifications To improve the data quality, a HIT can also be attached to certain tests, “qualifications” ... substantial In the field of automatic summarisation, the overlap of the automatic results and corresponding manual summarisations is generally much lower than the overlap between our answers (Chali...
- 9
- 610
- 1
The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx
... Supplier Standards Product LCA Human Rights Standards International Standards Compliance National Standards Compliance EMS Environmental Data Availability Environmental Policy Grievance Process Labor ... environmental and social dynamic data supplier RepRisk Finally, SAM analysts personally contact companies to clarify any issues that may arise from the analysis of the MSA, the questionnaire, and the ... Sustainability Assessment is supplemented with a Media and Stakeholder Analysis (MSA) The Media and Stakeholder Analysis allows SAM to identify and assess issues that may represent financial, reputational,...
- 57
- 447
- 0
ecovillage at ithaca pioneering a sustainable culture - liz walker
... the World Habitat Awards, and we have received E C O V I L L A G E AT I T H A C A delegations of visitors from China, Japan, Europe, Australia, and Canada We have been featured on national television ... organized into six topic areas: agriculture, natural areas and recreation, neighborhood siting, transportation, village siting, and water/waste management A convenor was assigned to each topic area ... process) Additional thanks go to Jalaja Bonheim, Tina Nilsen-Hodges, Margery and Alan Walker, Lars Walker, Rachel Cogbill, and Daniel Katz Thanks to Phebe Gustafson for fact-checking, to Betsy Crane...
- 257
- 263
- 0
the emergence of a scientific culture science and the shaping of modernity 1210-1685 feb 2007
... offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey Ukraine Vietnam Oxford is a registered ... that is value-free realize human ideals and aspirations? The answer is that it cannot, and what in fact happens instead is that scientific, technological, and economic goals replace—rather than ... Barenblatt, A Plague upon Humanity: The Hidden History of Japan’s Biological Warfare Program (New York, 2005) Cf Edwin Black, War Against the Weak: Eugenics and America’s Campaign to Create a...
- 574
- 285
- 0
bottle creek a pensacola culture site in south alabama mar 2003
... remembering that southeastern archaeology began in south xxii / Foreword Alabama and it was directed to the late Renaissance antiquarian desire to join New World archaeological and ethnographic objects ... Examples of Coastal Plain agate microblades and ®akes from Unit A1 02, Level P, Mound L 177 9.4 Examples of Coastal Plain agate ®akes and shatter from Unit A1 02, Level Q, Mound L 178 10.1 Fabric ... site and perhaps not What is certain is that this quasi-archaeological expedition was designed to augment the Parisian Cabinet of the learned King of France with statues taken from a pagan shrine...
- 311
- 173
- 0
báo cáo hóa học: " Integration of immigrants into a new culture is related to poor sleep quality" pptx
... related to cultural or nutritional factors It is also possible that the generally more active hypothalamic-pituitary-adrenal axis in women contributes to a greater variability in sleep quality among ... interviewers, carried out the statistical analyses and drafted the manuscript Inka Tuin conceived of the study, participated in its coordination and the statistical analysis, and helped to draft the manuscript ... translated into Portuguese by professional translators and translated back into German by the accompanying translators The interview was identical to the one given to the Moroccan women Internal...
- 6
- 435
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of recTULV S RNA, ... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family ... was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and Page of (page number not for citation purposes) Virology Journal 2005, 2:12 RECR855 (5'TTCTCTCCCAATTAGGTAAGCATCA3';...
- 5
- 483
- 0
báo cáo hóa học: "Fibrillar beta-amyloid peptide Aβ1–40 activates microglial proliferation via stimulating TNF-α release and H2O2 derived from NADPH oxidase: a cell culture study" doc
... contain dead and dying neurons and their processes, inflammatory-activated microglia and β-amyloid peptides A 1–40 and A 1–42 [1,2] The disease is accompanied by brain inflammation, characterised ... glia, and inflammatoryactivated microglia are consistently found in the neuritic plaques of Alzheimer's patients [1,2] β-Amyloid, cytokines and/or bacteria-activated microglia potently kill co-cultured ... activated by β-amyloid, bacteria and/or cytokines, the oxidase assembles at the plasma membrane, and produces superoxide that is released extracellularly or into phagosomes at a high rate The superoxide...
- 13
- 388
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
... RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of recTULV S RNA, ... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family ... was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and Page of (page number not for citation purposes) Virology Journal 2005, 2:12 RECR855 (5'TTCTCTCCCAATTAGGTAAGCATCA3';...
- 5
- 430
- 0
Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx
... channels and beyond: mechanisms of temperature sensation Nat Rev Neurosci 2003, 4:529-539 30 Amaya F, Oh-Hashi K, Naruse Y, Iijima N, Ueda M, Shimosato G, Tominaga Y, Tanaka Y, Tanaka M: Local inflammation ... neurones were examined with a light microscope (Axioplan 2, Zeiss, Germany) coupled to a CCD video camera and an image analysing system (KS 300, Zeiss, Germany) The mean area and mean grey value were ... Clapham C, Atkinson K, et al.: Vanilloid receptor-1 is essential for inflammatory thermal hyperalgesia Nature 2000, 405:183-187 29 Papapoutian A, Peier AM, Story GM, Viswanath V: ThermoTRP channels...
- 12
- 184
- 0
Báo cáo y học: "Ethnomedicine and ethnobotany of fright, a Caribbean culture-bound psychiatric syndrome" ppsx
... a backache treatment throughout the area French Guianese and several native Guiana groups (Caribs and Arawaks in Surinam; Palikur and Wayapi in French Guiana, Patamona in Guyana) boil G barbadense ... Drosophila melanogaster” British Journal of Pharmacology 2003, 140:1363-1372 103 Watanabe M, Maemura K, Kanbara K, Tamayama T, Hayasaki H: “GABA and GABA receptors in the central nervous system and other ... stomach problems and as sedatives ([80] and [84] for review of L alba in South America) For example, Jamaicans use L alba for insomnia [5], and Brazilians use L alba and L geminata as sedatives...
- 18
- 333
- 0
The use of credit scoring models and the importance of a credit culture
... Empresas ICA Sociedad Controladora Grupo Televisa SA Kimberly-Clark de Mexico Telefonos de Mexico SA de CV Vitro SA de CV n .a: not available BBBBB+ BB BB+ Dec 94 n .a AAA BBBABBB AA AAA AAA BB+ ... D AAA BBBBBBBB BBB ABB+ B+ BB BBBBBBBBBBBBAAA AAA BB+ A CCC BBB+ BB+ CCCCCC+ AAA AA BB+ BB+ D A B+ BBBB+ BB+ BB BBB+ BB+ BB BBBB+ BB+ BBBBAA A+ BB+ BB CCCB BB CCC B AABBB+ BB+ BB NR/NR/NR Ba2/NR/NR ... estimate annual and cumulative defaults 10 Marginal and Cumulative Mortality Rate Equation MMR(t) = Total value of defaulting debt in year (t) total value of the population at the start of the year...
- 90
- 916
- 0
Online collective action toward a democratic culture a network perspective of commons based peer production
... survey dataset was analyzed using factor analysis, reliability analysis, and regression analysis Another method is the Social Network Analysis (SNA) It maps how CBPP members are socially connected ... professional and amateur and are characterized by collaboration and some relinquishing of authorial control Lessig claims that the RW culture asks more from the audience; it offers cultural work as draft, ... study I also want to thank my fellow graduate students of CNM programme, especially the batch of January 2009, who have made II my past two years an enjoyable and memorable experience Finally, a million...
- 150
- 222
- 0
Mathematical modelling of a suspension culture microenvironment
... Survival stimulation was highest in Fractions and and was similar to that found with CM Fractions and were found to have marginally higher stimulation than GM The Fractions 1, 2, and were then analyzed ... and the structural constraints of the extracellular space was found to affect the binding and 12 receptor activation of glutamate receptors [71] A more detailed mathematical model further quantified ... a comparative survival assay Cells were mechanically dissociated and plated as single cells in 96 well plates using FACS Propidium Iodide was used to mark for and exclude dead cells The clonal...
- 106
- 176
- 0
Creating a transformative culture of learning
... Rudolph Tanzi Creating a Transformative Culture of Learning The Big Hippocampus Amygdala Basal ganglia Creating a Transformative Culture of Learning Hippocampus The “data drive” Moves learning ... videos Avg 750 released per week Creating a Transformative Culture of Learning Agenda Learning Culture Transformative Learning Benefits/ROI Create a Culture of Transformation Creating a Transformative ... teachers are identified and cultivated Change and innovation are embraced Learning is designed to be transformative 25 Creating a Transformative Culture of Learning Agenda Learning Culture Transformative...
- 55
- 230
- 0
Cours:INTRODUCTION À LA CULTURE VIETNAMIENNE
... PLAN Les notions de base de la culture Les notions de base de la culture vietnamienne La culture et la société La culture et l’organisation de la communauté LA CULTURE • • • • • “Cultura” (lat.): ... travail Des échanges Le patrimoine social accumulé et transmis de génération en génération La langue La culture vs la civilisation • - Pierre Huard et Maurice Durand: - Culture: certaine manière ... communauté Joindre les mains devant la poitrine, baisser la tête La culture nomade - Le climat: froid, sec - Les savanes - L’élevage des animaux, vie nomade - Mode de vie fondée sur le déplacement...
- 18
- 419
- 0
PROMOTING A UNIVERSITY CULTURE OF INNOVATION AND PRODUCT DEVELOPMENT FOR IGR
... Public Relations Institute of Australia (PRIA) defines Public Relations (PR) as: “The deliberate, planned and sustained effort to establish and maintain mutual understanding between an organisation ... brand, generating sales, and creating brand loyalty CULTURE • relates to the habits, beliefs, and traditions of a certain people ; • it is the characteristics and knowledge of a particular group ... of a process and serves a need or satisfies a want • a combination of tangible and intangible attributes (benefits, fea tures, functions, uses) that a seller offers a buyer for purchase For example...
- 35
- 326
- 0
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... there are many races such as white, black or African-American, American Indian or Alaska native, Asian, native Hawaiian, other Pacific Islander and ethnic groups due to immigrations from all around ... picture of an American woman in the late 1920s Doreen Sulivan, a beautiful woman from Philadelphia, had an appearance which was a fashion of the day with a thin, sleeveless dress over a light camisole, ... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another...
- 49
- 785
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose