clinical reasoning a basis for examination and treatment in the cranial region

Tài liệu English Style Guide A handbook for authors and translators in the European Commission pptx

Ngày tải lên : 24/02/2014, 18:20

... of the Scandinavian peninsula, i.e Norway and Sweden In practice, however, it includes Denmark and is often stretched to cover Finland As a cultural term, ‘Scandinavian’ also embraces Iceland and ... countries of the Nordic Council, i.e Denmark (including the Faeroes and Greenland), Finland (including Åland), Iceland, Norway and Sweden, use ‘Nordic’ rather than ‘Scandinavian’ in terms such as ‘Nordic ... body, for example an international organisation, has an official name in English, always use that: World Organisation for Animal Health (rather than Organisation Mondiale de la Santé Animale)...

94
1.1K
0

RESEARCH ON PLANT DIVERSITY IN FOREST ECOSYSTEMS OF XUAN SON NATIONAL PARK IN PHU THO PROVINCE AS a BASIS FOR PLANNING AND CONSERVATION WORK

Ngày tải lên : 21/07/2016, 10:39

... BIGNONIACEAE Markhamia cauda-felina (Hance) Craib Fernandoa brilletii (P.Dop) Steenis BURSERACEAE Canarium tonkinensis L CAESALPINIACEAE Senna siamea Lam DIPTEROCARPACEAE Hopea chinensis (Merr.) Hand.-Mazz ... Representatives are often families of Rosaceae, Lauraceae, Apocynaceae, Theaceae, Magnoniaceae, Juglandaceae, Fagaceae, Aceraceae, etc (6) Xuan Son National Park has high differentiation on vegetation ... Fagaceae, Camellia sinensis The secondary forest of restoration after exploitation: species are often Castanopsis armata, C tessellata, Lithocarpus elegan, Aglaia gigantea, Vatica odorata, Machilus...

27
532
0

Woody Biomass for Bioenergy and Biofuels in the United States— A Briefing Paper doc

Ngày tải lên : 18/03/2014, 02:20

... common in the South and Lake States If planted for energy, the Northeast and possibly the Corn Belt may be the areas of planting focus If there is a rapid increase in the demand for biomass for ... structural diversity in the remaining stand and two aimed at achieving limited structural diversity in the remaining stand In the uneven-age scenarios, stems in a variety of diameters were removed In ... discarded into landfills In MSW, woody biomass can be found in paperboard and paper waste, discarded wood products such as furniture, durable goods, crates and packaging, and in yard trimmings In...

56
544
1

woody biomass for bioenergy and biofuels in the united states a briefing paper pdf

Ngày tải lên : 18/03/2014, 20:20

56
353
0

báo cáo khoa học: " A role for neurotransmission and neurodevelopment in attention‑deficit/hyperactivity disorder" ppsx

Ngày tải lên : 11/08/2014, 12:20

... 17q25 and encodes the 53 kDa insulin receptor tyrosine kinase substrate protein (IRSp53), a molecule that participates in the signal transduction path ways of insulin and insulin-like growth factors ... genes, an association with BAIAP2 was detected, by both the singleand multiple-marker analyses, in the adult ADHD Spanish sample In the replication study, the association with this locus was also ... therapies for ADHD Competing interests LAR has served as a speaker and/ or consultant for Eli Lilly, Janssen-Cilag and Novartis in the past years Currently, his only industry-related activity is taking...

3
329
0

Báo cáo y học: " Cyanide intoxication as part of smoke inhalation a review on diagnosis and treatment from the emergency perspective" pps

Ngày tải lên : 13/08/2014, 23:20

... poisoning Whether HBO therapy holds any place in the treatment of acute CN poisoning when readily available is a matter of continued debate In keeping with the above and the fact that patients ... detect and measure CN in blood are usually not readily available and that patients may often be exposed to both CO and CN, clinicians have to rely on the presenting symptoms and the general clinical ... CN is an unstable molecule and has an elimination half-life of hour in blood in vivo Therefore determination of CN in blood requires rapid sampling and analysis [25,27] Treatment The treatment...

5
393
0

A handbook for teaching and learning in higher education enhancing academic and practice

Ngày tải lên : 14/08/2016, 15:49

... A Handbook for Teaching and Learning in Higher Education A Handbook for Teaching and Learning in Higher Education is sensitive to the competing demands of teaching, research and scholarship, ... notably in teaching, research and scholarship, supervision, academic administration and management and, for many, maintenance of standing and provision of service in a profession (such as teaching ... arts Alison Shreeve, Shân Wareing and Linda Drew 345 23 Key aspects of teaching and learning: enhancing learning in legal education Tracey Varnava and Julian Webb 363 24 Key aspects of teaching and...

544
700
0

Tài liệu Integrated Management of Childhood Illness Caring for Newborns and Children in the Community doc

Ngày tải lên : 21/02/2014, 14:20

... than days) in a malaria area Advise the caregiver to give more fluids and continue feeding Do a rapid diagnostic test (RDT) If RDT is positive, give oral antimalarial AL (Artemether-Lumefantrine) ... If any DANGER SIGN SICK but NO Danger Sign REFER CHILD WITH DANGER SIGN URGENTLY TO HEALTH FACILITY TREAT diarrhoea, malaria, and fast breathing at home and Begin treatment and Assist referral ... kind, either expressed or implied The responsibility for the interpretation and use of the material lies with the reader In no event shall the World Health Organization be liable for damages arising...

14
575
0

2009 Investment Company Fact Book 49th edition - A Review of Trends and Activity in the Investment Company Industry pptx

Ngày tải lên : 23/03/2014, 08:21

... draw and the rule changes that they make will shape the ﬁnancial and regulatory landscape for another generation or more The regulatory overview includes how the money market will operate in the ... Governors and at the Reserve Bank of New Zealand He has a PhD in economics from the University of California, Santa Barbara, and a BA in economics from Claremont McKenna College RETIREMENT AND INVESTOR ... ETFs a convenient vehicle for participating in, or hedging against, broad movements in the stock market Retail investors and their ﬁnancial advisers have become increasingly aware of these investment...

208
734
0

2011 Investment Company Fact Book - A Review of Trends and Activity in the Investment Company Industry doc

Ngày tải lên : 23/03/2014, 11:20

... Americans because it replaces a large share of annual labor income for many low- to moderate-income families At the same time, the creation of IRAs in the 1970s and the expansion of 401(k)s and ... economist at the Federal Reserve Board of Governors and at the Reserve Bank of New Zealand He has a PhD in economics from the University of California, Santa Barbara, and a BA in economics from Claremont ... European Fund and Asset Management Association, and other national mutual fund associations both the number and relative size of firms in the industry Index numbers below 1,000 indicate that an industry...

252
2K
0

Báo cáo khoa học: "A Tradeoff between Compositionality and Complexity in the Semantics of Dimensional Adjectives" potx

Ngày tải lên : 01/04/2014, 00:20

... computational advantage gained in the reasoning process The incompleteness of reasoning under the compositional approach is unacceptable for an application if it is crucial that the inferred intervals ... that they entail In particular, I will investigate the complexity of constraint propagation in a system where the meaning representations appear as constraints In this paradigm, uncertain quantitative ... reasoning are dependent on the types of relations that appear in the knowledge base Thus in the present paper, I investigate the kinds of relations that appear in formal theories of the meanings...

10
537
0

Báo cáo khoa hoc:" An expression of mixed animal model means equations to account for different and variances in the base" pps

Ngày tải lên : 09/08/2014, 18:21

... is altered and, in particular, it is no longer valid to assume that the breeding values of the base animals have the same mean and variance, and that the genetic variance of the base generation ... are The calculation of G is simplified if all the groups are assumed to have * the same additive genetic variance, and base animals are unrelated and non1 * inbred, because in that case Gis the ... Now, calling breeding values of base ) b (a and non-base animals equa- ) r (a and Z l 2] [Z Z the prediction of breeding values when base animals selected is then obtained by solving the following...

9
397
0

Báo cáo y học: "TLR4 signalling in pulmonary stromal cells is critical for inflammation and immunity in the airways" pdf

Ngày tải lên : 12/08/2014, 14:20

... domain-containing adaptor protein (TIRAP) bridging MyD88 to TLR4 MyD88 and TIRAP are involved in early activation of NF-B and MAPK [16-19], whereas TRIF and TRAM are critical for late activation ... demonstrated in alveolar and bronchial epithelial and vascular endothelial cells [23,31,32] Sha et al demonstrated that ECs express mRNA for all TLR and that several known TLR ligands activate epithelial ... evidence that LPS can use MyD88-independent signalling pathways [11] In particular, other adaptor proteins such as TIR domain-containing adaptor inducing IFN-b (TRIF)3 [12,13] and TRIF-related adaptor...

8
296
0

Báo cáo y học: "Collective consciousness and its pathologies: Understanding the failure of AIDS control and treatment in the United States" doc

Ngày tải lên : 13/08/2014, 16:21

... 37:73-83 Laxmisan A, Hakimzada F, Sayan O, Green R, Zhang J, Patel V: The multitasking clinician; Decision-making and cognitive demand during and after team handoffs in emergency care International ... a huge gap, not only in survival rates, but in access to care and in understanding the treatments Again, the men have had opportunities for education and jobs, they're more out in the world and ... anthropologists, the structures, functions, and innate character of organizational behavior are greatly variable and highly adaptable across social and physical geography, and across history Individual human...

36
376
0

a history of money and banking in the united states; the colonial era to world war ii

Ngày tải lên : 05/11/2014, 10:45

... Britain also coined gold and maintained a bimetallic standard by fixing the gold guinea, weighing 129.4 grains of gold, as equal in value to a certain weight of silver In that way, gold became, in ... children in the nursery and kindergarten, by businessmen in trade, by politicians and statesmen in affairs of state All are eager to get information about other people’s valuations and plans and to appraise ... financial interests shaped the politics and behavior of the Fed during the Hoover administration and the first Roosevelt administration as well as international monetary and domestic banking and financial...

512
646
0

Business strategy construction for Vietnam Joint Stock Commercial Bank for industry and trade in the period of 2012-2015

Ngày tải lên : 26/03/2015, 10:48

75
623
0

Báo cáo y học: "Functional constraint and small insertions and deletions in the ENCODE regions of the human genome" ppsx

Ngày tải lên : 14/08/2014, 08:20

... selection and are used to rank and characterize constrained elements GERP scores are positive in constrained regions and negative in neutral DNA [26], and MCS scores are high in constrained regions and ... 9, Article R180 Clark et al Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, et al.: Initial sequencing and comparative analysis ... and TA analysed the indel data and wrote the manuscript GC generated the evolutionary constraint scores and JM generated the shotgun indel data EM, GC, JM and DB provided detailed advice and commented...

14
319
0

Efficiency Of Economic Linkage Between Enterprises And Farmers In The Southeast Region - The Current Situation And Affecting Factors

Ngày tải lên : 13/08/2015, 10:01

... cooperation in agriculture southeast region on the basis of qualitative and quantitative research methods, based on the primary data was collected from the farmers who engaged in agricultural production ... on the level of convenience and where the affiliate program is being implemented After the data is cleared and evaluated the standart distribution will be analyzed by using SPSS and AMOS software ... that affect the efficency of the cooperation and the last part is the general information about the interviewees The Current Situation and the factors affecting the efficiency of the economic linkage...

16
390
1

Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Ngày tải lên : 12/08/2014, 23:23

... Laboratory Animals, as well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All ... possible strategies for eliminating viral reservoirs or the testing of therapeutic vaccines For example, an easy and rapid preliminary assessment of the impact of a candidate eradication strategy could ... SIV2-D 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from...

19
317
0

Social factors as a basis for treatment

Ngày tải lên : 01/11/2013, 09:20

... in the USA, 29 in Scandinavia, 23 in Canada, 22 in the British Isles and others in Australia, New Zealand, Japan, Korea and some European countries (ICCD, 2004) The basic components of the clubhouse ... reputation and entertaining hundreds of visitors each year In 1976, Fountain House launched a national training programme and in 1988, a national expansion effort The International Center for Clubhouse ... schizophrenia in an urban area of India Psychiatric Services, 56, 1423–8 Stein, L I and Test, M A (1980) Alternative to mental hospital treatment: I Conceptual model, treatment program, and clinical evaluation...

16
524
0