chromogranins secretogranins derived peptides production lytic activity and processing by bacterial proteases
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
Ngày tải lên :
17/03/2014, 17:20
... ATGGAGCTGTCTAGAGGATCCGA) A three-strand junction was made by omitting strand and a 37-bp duplex DNA by annealing oligonucleotides (bio-AATGCTA CAGTATCGTCCGGTCACGTACAACATCCAG) and (CTGGATGTTGTACGTGACCGGACGATACTGT ... between MpRuvA and branched DNA substrates and its inability to form heterologous complexes with E coli Ruv proteins reveal important differences in junction binding and processing by Mycoplasma ... are negatively charged residues located nearby in the RuvA sequences from M pneumoniae, M genitalium, and U urealyticum and Holliday junction bound by EcRuvA (Table 1), illustrating the additional...
- 9
- 542
- 0
Design, optimization and structure activity relationship study of CD2 derived peptides for immunomodulation
Ngày tải lên :
04/10/2015, 15:46
... small peptides derived from CD2 ligand binding epitopes can modulate CD2-CD58 interaction by mimicking the native β-turn structure 12-amino acid cyclic peptides (cER and cVL from rat CD2; cAQ and ... β-strands (CC’, C’C’’ and FG loop) The parent peptides were then subjected to truncation and alanine scanning for optimization Finally, the biological activity and secondary structure of the peptides ... cell activity and perpetuation of inflammation [61,62] 1.3.7 Therapeutic potential of CD2 and its ligands Better understanding of the critical roles of CD2/CD58 interaction in immune regulation and...
- 173
- 322
- 0
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf
Ngày tải lên :
23/03/2014, 21:21
... were fixed and double-stained with polyclonal antip35 (C-19) and anti-AT8 Ig (a, c, and e) and with polyclonal antip35 (N-20) and anti-AT8 Ig (b, d, and f) a and b expressed transfected p25 and p35, ... Cdk5 activity and binds with high affinity (C) Inhibition of Cdk5 activity by CIP Cdk5 kinase activity was determined by preincubating various amount of CIP with Cdk5/p25 for h at 30 °C followed by ... constructs of CIP and tau peptides were verified by sequencing Cell culture and transfection Fig Identification of the Cdk5/p25 inhibitory peptide (CIP) derived from p35 (A) Mapping of p25, p16 and CIP to...
- 8
- 329
- 0
Báo cáo Y học: Interactions between the Fyn SH3-domain and adaptor protein Cbp/PAG derived ligands, effects on kinase activity and affinity docx
Ngày tải lên :
24/03/2014, 00:21
... 1C), flanked by strands b4 and b5 The variable loops n-Src and RT are principal determinants for ligand recognition, orientation, and specificity of this domain, with residues Tyr91 and Tyr137 forming ... and assayed for binding by passing the peptides PRD1, PRD1-RLP* and PRD1super over immobilized proteins Thus, a single chip was used for all peptides, minimizing effects of variations in ligand ... the Fyn SH3-domain and PAG -derived peptides The interaction pockets of the SH3-domain are made by loops linking the individual b strands together (the RT loop, the n-Src loop, and the 310 helix...
- 12
- 617
- 0
Báo cáo khoa học: Kininogen-derived peptides for investigating the putative vasoactive properties of human cathepsins K and L docx
Ngày tải lên :
31/03/2014, 07:20
... Intramolecularly quenched fluorogenic Fig Hydrolysis of kininogen -derived peptides and kinins by hK1 and cathepsins B, L and K (A) Structure of kininogen -derived fluorogenic substrates The sequence surrounding ... and the reaction stopped by adding 800 lL ethanol The precipitate was removed and the supernatant, containing the native peptide and/ or its proteolytic fragments, was evaporated to dryness, and ... products were identified by N-terminal peptide sequencing [32] substrates (N-BK and C-BK peptides) were prepared as peptidyl-amides by Fmoc solid-phase synthesis, and were flanked by a fluorescent N-terminal...
- 8
- 482
- 0
Báo cáo sinh học: " Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein" doc
Ngày tải lên :
19/06/2014, 08:20
... virus and Nipah virus infection by N-terminal and C-terminal pegylated heptad peptides Inhibition of Hendra virus and Nipah virus infection by N-terminal and C-terminal pegylated heptad peptides ... conceived and contributed to design and use of heptad derived peptides as fusion inhibitors for henipaviruses and PEG-linked versions of peptides, provided overall supervision and financial support and ... mediated by the envelope glycoproteins of HeV and NiV [25,34] Although both HR-1 and HR-2 derived peptides exhibited fusion inhibitory activity, the HR-2 peptide (residues 447–489) was more potent and...
- 15
- 387
- 0
báo cáo hóa học:" Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein" doc
Ngày tải lên :
20/06/2014, 04:20
... virus and Nipah virus infection by N-terminal and C-terminal pegylated heptad peptides Inhibition of Hendra virus and Nipah virus infection by N-terminal and C-terminal pegylated heptad peptides ... conceived and contributed to design and use of heptad derived peptides as fusion inhibitors for henipaviruses and PEG-linked versions of peptides, provided overall supervision and financial support and ... mediated by the envelope glycoproteins of HeV and NiV [25,34] Although both HR-1 and HR-2 derived peptides exhibited fusion inhibitory activity, the HR-2 peptide (residues 447–489) was more potent and...
- 15
- 266
- 0
Báo cáo y học: " Glycine tomentella Hayata inhibits IL-1b and IL-6 production, inhibits MMP-9 activity, and enhances RAW264.7 macrophage clearance of apoptotic cells" docx
Ngày tải lên :
10/08/2014, 05:21
... later and the cytokines were analyzed by ELISA Consistent with the results that GTH treatment suppressed mRNA expression of proinflammatory cytokines by RT-PCR, the production of IL-1b and IL-6 ... the activity of MMPs in LPS-stimulated macrophages, RAW264.7 cells were incubated with different concentrations of GTH, followed by stimulation with LPS as described and the activity of MMP-2 and ... decreased NO production in LPS-stimulated RAW264 cells [7] and inhibited iNOS expression and NO production in murine J774 cell line[8] However, these studies were performed with individual and purified...
- 9
- 217
- 0
Báo cáo y học: "Pravastatin Provides Antioxidant Activity and Protection of Erythrocytes Loaded Primaqe"
Ngày tải lên :
25/10/2012, 11:40
... fragility and oxidative damage of erythrocytes of zinc-deficient rats J Nutr 1997; 127: 1290–1296 Lajos N, Miki N, Sandor S Protein and non-protein sulfhydryls and disulfides in gastric mucosa and ... samples were washed with alcohol and ethyl acetate, and re-precipitated by addition of 10% TCA The precipitated protein was dissolved in M guanidine hydrochloride solution and measured at 370 nm Calculations ... all donors The blood was centrifuged for at 1500 rpm The plasma and buffy coat were removed by aspiration to eliminate leucocytes and platelets; erythrocytes were washed three times in cold phosphate...
- 8
- 537
- 0
INFLUENCE OF NITROGEN, ACETATE AND PROPIONATE ON HYDROGEN PRODUCTION FROM PINEAPPLE WASTE EXTRACT BY Rhodospirillum rubrum
Ngày tải lên :
05/09/2013, 09:08
... hydrogen and resulted to butyrate and acetate production (Figures 1, 2) Figures and illustrated a reduction of glucose concentration and an increase of acetate and butyrate during hydrogen production ... explained by Khanal et al (2004) The specific hydrogen production potential, Ps (ml/g Chemical Oxygen Demand-COD), was obtained by dividing P by COD of substrate applied, while the specific hydrogen production ... algae and photosynthetic bacteria (Ike et al., 1997; Melis and Happe, 2001) Fermentative system, on the other hand, is carried out by facultative anaerobes and obligate anaerobes (Joyner and Winter,...
- 25
- 495
- 0
Tài liệu Physical Activity and Women’s Health pptx
Ngày tải lên :
13/02/2014, 08:20
... occupational and leisuretime activity was combined and subjects were grouped into three activity classifications A strong inverse relationship was found between physical activity and CHD mortality ... observational and experimental evidence that physical inactivity plays a significant role in the development of cardiovascular disease in women, and that habitual physical activity and at least ... based programs in schools and communities that are culturally sensitive and ethnic-specific R EF ER EN CE S Albanes, D., Blair, A., and Taylor, P.R (1989) Physical activity and risk of cancer in...
- 12
- 588
- 0
Tài liệu Time trends in leisure time physical activity and physical fitness in elderly people: 20 year followup of the Spanish population national health survey (1987-2006) docx
Ngày tải lên :
14/02/2014, 06:20
... proportional random selection of primary and secondary sampling units (towns and sections, respectively), with the final units (individuals) being selected by means of random routes and sex- and age-based ... sleeping > hours per day and those sleeping < hours per day Statistical analysis In this study we analyzed physical activity and physical fitness separately for men and women and we excluded respondents ... http://www.biomedcentral.com/1471-2458/11/799 Page of 11 Table Time trends by gender and age group in leisure time physical activity and physical fitness between 1987 and 2006 WOMEN Age group SNHS 1987 SNHS 1993 SNHS...
- 11
- 912
- 0
Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx
Ngày tải lên :
14/02/2014, 19:20
... = 9.76 · 10)10 M and AzU = 50.8 · 10)10 M and for the wild-type XAN, X6U = 1.02 · 10)10 M, XyU = 7.72 · 10)10 M and AzU = 9.65 · 10)10 M for the activity on X6, Xylazyme AX and Azo-wheat AX, ... affecting the real catalytic potential and substrate specificity of the enzyme 1102 Optimal conditions XAN By contrast to results on XBS, the activity on X6 is affected by a number of the mutations ... (WU-AX) (A) and oat spelt xylan (OSX) (B) by B subtilis xylanase mutants with a modified secondary binding site and of water-unextractable arabinoxylan (C) and oat spelt xylan (D) by A niger xylanase...
- 14
- 600
- 0
Tài liệu Báo cáo khoa học: Processing, catalytic activity and crystal structures of kumamolisin-As with an engineered active site pptx
Ngày tải lên :
19/02/2014, 07:20
... glutamate-mediated catalytic triad and an aspartic acid residue in the oxyanion hole of sedolisins for their lowpH peptidase activity Results Processing and purification of mutants The D164N and E78H ⁄ D164N ... time-dependent enhancement of the 57-kDa band with a concomitant diminution of the 38-kDa and 19-kDa bands, as analyzed by SDS ⁄ PAGE (Fig 3A) The 38-kDa and 19-kDa bands did not disappear completely ... altered behavior with respect to the processing of its precursor and the pHdependent kinetics, which appeared to be mediated by the Ser278-His78 dyad and by Asn164 The results, in turn, corroborate...
- 14
- 458
- 0
Tài liệu Activity Data on Fundraising, Investments and Divestments by Private Equity and Venture Capital Firms in Europe 2012 ppt
Ngày tải lên :
19/02/2014, 09:20
... (Estonia), EVCA (Europe), FVCA (Finland), HVCA (Hungary), IVCA (Ireland), LTVCA (Lithuania), NVCA (Norway), NVP (the Netherlands), PPEA (Poland), SECA (Switzerland), SEEPEA (South Eastern Europe), ... (Estonia), EVCA (Europe), FVCA (Finland), HVCA (Hungary), IVCA (Ireland), LTVCA (Lithuania), NVCA (Norway), NVP (the Netherlands), PPEA (Poland), SECA (Switzerland), SEEPEA (South Eastern Europe), ... Investments by region 2011 - Industry vs Market statistics – Amount By country of the PE firm Nordics 8% By location of the portfolio company CEE 3% CEE 3% Nordics 14% Southern Europe 8% UK & Ireland...
- 48
- 426
- 0
Tài liệu Báo cáo khoa học:Symmetric fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve binding efficacyy docx
Ngày tải lên :
19/02/2014, 16:20
... autocatalytic processing of the precursor protein and thereby ensure a correct N-terminus Through the PCR step, the protease DNA fragment was provided with an NdeI restriction site at the 5¢ end and ... extends the contact surface and has polarity differences This is documented by the threefold improvement in activity of inhibitors and against the triple mutant M46I, I82V and V84A compared with the ... Padgett, W.L., Oshunleti, O., Daly, J.W & Kirk, K.L (2000) Syntheses of (R )and (S)-2- and 6-fluoronorepinephrine and (R)- and (S)-2- and 6-fluoroepinephrine: effect of stereochemistry on fluorine-induced...
- 9
- 560
- 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
Ngày tải lên :
20/02/2014, 11:20
... Na2HPO4) and opened with sonication The bacterial lysates were cleared by centrifugation (15 000 g, 30 min) and filtration (0.22 lm), supplemented with M NaCl, 10 mM imidazole and 5% glycerol, and ... behaviour and a low unstable inhibitory activity, and for I137A a biphasic loss of activity (Fig and Table 3) The phenotype of these substitutions is therefore different from that of N139A, T146A and ... specific inhibitory activity towards uPA was determined in a peptidolytic assay and expressed as percentage of the theoretical maximum The activity was monitored over time and the rate of latency...
- 9
- 605
- 0
Tài liệu Báo cáo khoa học: Changes in rat liver mitochondria with aging Lon protease-like activity and N e-carboxymethyllysine accumulation in the matrix doc
Ngày tải lên :
20/02/2014, 11:20
... purity ATP-stimulated protease activity in aging rats Fig Lon protease quantification and activity in liver mitochondrial matrix from 10- and 27-month-old rats Activity was determined in the absence ... exhibited a comparable pattern of bands, although two bands of 60 and 150 kDa strongly visible at 10 months (lane 1) were absent at 27 months, and an important band of 70 kDa (lane 2) emerged in ... intense signals of 70 and 50 kDa, while the bands at 60 and 150 kDa vanished With oxyblot (Fig 4C), antibodies stained carbonylated proteins mainly in band ranges of 30–60 and 70–120 kDa at 10...
- 8
- 412
- 0
Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf
Ngày tải lên :
20/02/2014, 23:20
... Kdo, and tetrasaccharide 1-monophosphate (TS 1-MP) One-dimensional 1H- and 31P-, and two-dimensional homo- (1H,1H-DQF-COSY) and heteronuclear (1H,13C-,1H,31P-HMQC) NMR spectroscopy (Figs and 6) and ... mononuclear cells and granulocytes ¨ from human blood Isolation of monuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at g Scand J Clin Laboratory ... from C trachomatis serotype E and L2 were of similar activity and both less active than smooth LPS by a factor of 100 whereas, LPS from Chl psittaci was of lower activity than the two other chlamydial...
- 11
- 560
- 0
Tài liệu Báo cáo Y học: Interaction of decorin with CNBr peptides from collagens I and II Evidence for multiple binding sites and essential lysyl residues in collagen pot
Ngày tải lên :
21/02/2014, 15:20
... different peptides (c) Decorin might have two binding sites for collagen, as suggested by others and by the differential behaviour of collagen peptides Decorin is able to bind several CNBr peptides and ... Conformational analysis and stability of collagen peptides by CD and by 1H- and 13C-NMR spectroscopies Biopolymers 53, 99–111 30 Zanaboni, G., Rossi, A., Onana, A.M & Tenni, R (2000) Stability and networks ... collagen, by means of a combination of gel filtration chromatography followed by ion-exchange chromatography or by reverse-phase chromatography for the two smaller peptides [27,30] All collagens and peptides...
- 10
- 575
- 0