chemistry has an important role to play in achieving a sustainable civilization on earth — dr terry collins professor of chemistry carnegie mellon university
Tài liệu Báo cáo khoa học: The molecular surface of proteolytic enzymes has an important role in stability of the enzymatic activity in extraordinary environments pptx
Ngày tải lên :
21/02/2014, 03:20
... 5¢-GCCATTTCCATAtTgaGTaCTGTTACCAAG-3¢ 5¢-CATACTCAGCgTtaAC TAAGCCATTTC-3¢ 5¢-TTGAGCCGCAgcCTCAGCgTCgAC TAAGCCATTTC-3¢ 5¢-CTTAGGGATTAacGAGCCGCATACTCAGCgTCgAC TAAGCCATTTC-3¢ 5¢-ATTGAGCCGCAgcCTCAGCgTtaACTAAGCCATTTC-3¢ ... 5¢-ATTGAGCCGCAgcCTCAGCgTtaACTAAGCCATTTC-3¢ 5¢-CTTAGGGATTAacGcGtCGCATACTCAG-3¢ 5¢-CTTAGGGATTAacGcGtCGCAgcCTCAGCATCC-3¢ 5¢-CTTAGGGATTAacGcGtCGCAgcCTCAGCATtCACTAAGCCA-3¢ 5¢-TGCAGCTTCTGCgTcgACAAGTCCACTGCC-3¢ 5¢-AATATAAGCTTAaCgcGTTGCAtaTTCTGCgTcgAcAAGTCCACTGCC-3¢ ... 5¢-TTTGCTTCTCAtatgTTACCCTCTCC-6¢ 5¢-AATATAAGGGAcTCCCCAtGGAACAGTCTG-3¢ 5¢-CCCAAAGTAAGGTcGACGgTGcACAACATCCGA-3¢ 5¢-ATTCATCGCCCAcTCgAg TCCTTGAGCAAT-3¢ 5¢-GTTGGCAATATgCATCCCATTATT-3¢ 5¢-CTAGCGCGGTtTGCTGCcAgcTGCAGGGTTGT-3¢...
- 9
- 489
- 0
Báo cáo y học: "Pro/con debate: Octreotide has an important role in the treatment of gastrointestinal bleeding of unknown origin" pptx
Ngày tải lên :
12/08/2014, 23:24
... effect on decreasing portal pressure, somatostatin and analogues have been used in acute variceal bleeding In this patient population, metaanalyses [29] have shown no benefit of somatostatin over ... efficacy data, let alone cost considerations Somatostatin or octreotide can be considered in patients with NVUGB on a case-by-case basis, as additional pharmacotherapy, while awaiting endoscopy in ... rebleeding remains early endoscopy Competing interests AB is a consultant for AstraZeneca and Atlana Pharma References Reubi JC, Schaer JC, Laissue JA, Waser B: Somatostatin receptors and their...
- 4
- 395
- 0
Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx
Ngày tải lên :
09/08/2014, 07:21
... the accuracy of FNAC in the diagnosis of lymphomas as the tumours often contain malignant and reactive elements and the FNAC may only have sampled the reactive regions leading to false negative ... specimens was less than one month in 81% of cases and less than six weeks in all cases In cases of delay more than one month, delays were due to patient noncompliance Discussion The study has confirmed ... importance in the future is the role of endoscopy and laparoscopy in obtaining biopsy material The advent of endoscopic ultrasound-guided FNAC allows targeting of mediastinal and intra-abdominal...
- 4
- 435
- 0
Báo cáo y học: " Pro/Con Debate: Does recombinant factor VIIa have a role to play in the treatment of patients with acute nontraumatic hemorrhage" ppt
Ngày tải lên :
12/08/2014, 23:24
... Therefore, off-label use of FVIIa in this setting is not only warranted but also potentially beneficial and life saving Con: Recombinant FVIIa is not a cure for all bleeding Sandro Scarpelini and Sandro ... mortality, with increased incidence of respiratory failure and renal failure as well as multiple organ dysfunction FVIIa has efficacy in restoring hemostasis Additionally, early administration — ... he continues to hemorrhage Administration of FVIIa is certainly warranted in this patient Life-threatening hemorrhage and coagulopathy in critical care patients carries significant morbidity and...
- 4
- 304
- 0
Hydrophytes may play an important role in sewage disinfection in constructed wetlands
Ngày tải lên :
05/09/2013, 09:38
... International journal of antimicrobial agents., 10, 169~172 Farah Deba, Tran Dang Xuan, Masaaki Yasuda, et al (2008) Chemical composition and antioxidant, antibacterial and antifungal activities of ... sister chromatid exchanges, micronuclei and sperm-shape abnormality assays in mice (Bedoya et al., 2008) In short, plants play an important role in antibacterial activities and controlling virus ... antibacterial and antifungal activities Shen J G et al (2007) studied the anti-tobacco mosaic virus (TMV) about Ailanthus altissma and Brucea javanica, and indicated that their extracts not only inhibited...
- 7
- 417
- 0
Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx
Ngày tải lên :
18/06/2014, 18:20
... and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated ... 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the plasmids into T-REx 293 ... conditional mutant virus of A1 2L To examine the regulation of a conditional mutant virus of A1 2L (vvtetOA12L), we infected T-REx 293 cells with vvtetOA12L at various concentrations of Tet from to...
- 6
- 397
- 0
Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf
Ngày tải lên :
20/06/2014, 01:20
... and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated ... 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the plasmids into T-REx 293 ... conditional mutant virus of A1 2L To examine the regulation of a conditional mutant virus of A1 2L (vvtetOA12L), we infected T-REx 293 cells with vvtetOA12L at various concentrations of Tet from to...
- 6
- 401
- 0
Effective Presentations- Dilek Tokay Presentations play an important role in both docx
Ngày tải lên :
28/06/2014, 12:20
... use of audio-visuals and illustrations/ explanations/ demonstrations related to them If you have a lot of complex information to explain, think about using some charts, diagrams, graphs on screen/ ... understanding uses appropriate vocabulary in form & context LANGUAGE maintains flow of speech with natural pauses and speech markers/ attention pointers has no sentences left unfinished has good range ... overhead projector Using PowerPoint slides is an excellent way to present clear and precise information Audio-visual aids can make a presentation more interesting and easier to understand with...
- 6
- 269
- 0
Does dancing play an important role in a cultur2
Ngày tải lên :
29/08/2016, 20:57
... ( Word Reader - Unregistered ) www.word-reader.com secularism bringing and holding the whole world together with it`s threads of love and specific style of culture ...
- 2
- 286
- 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
Ngày tải lên :
21/02/2014, 01:21
... from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% ... listed in Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a ... GALA initially released D-galactotriose, D-galactotetraose and D-galactopentaose from potato and onion arabinogalactan, while after prolonged incubations predominantly D-galactotriose and D-galactotetraose...
- 9
- 669
- 0
Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot
Ngày tải lên :
23/03/2014, 03:20
... 5¢-GATTCTTAGCAGGTTCATCGCCATCT-3¢ 5¢-TGCACACACTTGGACAGAACAC-3¢ 5¢-GCGAAAACCTAGCTTGGGGAAG-3¢ 5¢-TATATAACGTGAAATGGACGC-3¢ 5¢-GAAGCTCTTCAGGAGGCACTTCCT-3¢ 5¢-CAATGGTGGGTACGCAGAGAGGAT-3¢ 5¢-GAAGCTTACGTTCCGATGCAAAGTC-3¢ ... vitro antimicrobial assay and in planta studies demonstrated that NtKTI1 is an antifungal protein that increases the resistance of tobacco to fungal attack Results Isolation and characterization of ... important phytopathogenic fungi: R solani, Rhizopus nigricans and Phytophthora parasitica var nicotianae The antifungal activity towards R solani was prominent (Fig 4A) , with antifungal action...
- 13
- 501
- 0
báo cáo khoa học: " Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses" ppt
Ngày tải lên :
11/08/2014, 11:21
... cis-elements (ABRE, MYBRS and MYCRS) and the corresponding transcription factors (AREB/ARF, MYB and MYC transcription factors) play important roles in the ABA signaling pathway and abiotic stress responses ... whereas secondary metabolism pathways, which could help to reduce ROS threat and maintain osmotic balance, such as the anthocyanin and isoflavone pathways were induced, indicating an active response ... post-germination salt tolerance, d after germination transgenic and wild-type seedlings were carefully transferred to new plates containing different concentrations of NaCl At a NaCl concentration of...
- 19
- 590
- 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
Ngày tải lên :
13/04/2013, 10:29
... Co-Branding Creating aa Creating Range Brand Range Brand Figure 2.3 : A Variety of Ways of Leveraging Brand Source: Aaker (1996) 13 2.11 Important Factors For Building Strong Brands To make brands ... create and maintain a strong brand To understand more how a company builds and manages its brand to get the full benefit from that, a study into the case of LiOA brand at Nhat Linh Co Ltd., an auto ... Company has used computers in managing its inventory and working out production plan as well as monitoring sales data in different areas The above internal analysis has shown the most important...
- 67
- 974
- 0
Report on the FAO Workshop on Sea Cucumber Fisheries An Ecosystem Approach to Management in the Pacific (SCEAM Pacific)
Ngày tải lên :
14/03/2014, 10:12
... supporting capacity building and active mentoring to the fishery managers and senior fishery officers as a means of bringing about changes to national fishery management plans INPUTS AND PARTICIPATION ... enforcement officer Samoa Solomon Islands Tonga Tuvalu Vanuatu Papua New Guinea Papua New Guinea Kiribati 8 7 1 Palau French Polynesia Marshall Islands New Caledonia Fiji Sustain fishing rates at a consistent ... planning, Papua New Guinea was granted the second participant (Luanah Yaman), and the Papua New Guinea National Fisheries Agency paid for her travel costs David Orrekum from Palau was originally...
- 56
- 481
- 0
AN INCREASING ROLE FOR COMPETITION IN THE REGULATION OF BANKS doc
Ngày tải lên :
29/03/2014, 08:20
... an important asymmetry between the information available to banks and the information available to depositors and other outside investors “Banks can utilize economies of scale and specialization ... tiny, and checking services are available without annual fees … Lemon Bank, which has 3600 access points, many in favelas and in drugstores, is about to launch a media campaign aimed at opening ... government-owned banks NMB was created in Tanzania after the privatisation in 1997 of the loss making rural branches of the National Bank of Commerce After an internal restructuring and a thorough reform of...
- 30
- 411
- 1
Golf Resorts Where to Play in the USA, Canada, Mexico, Costa Rica & the Caribbean 3rd Edition pdf
Ngày tải lên :
31/03/2014, 23:20
... iv Contents The Lahaina-Kaanapali Area Lahaina-Kaanapali Area Condominiums Kapalua Resort Area The Island Of Lanai The Island Of Molokai Idaho Ketchum-Sun Valley Area Illinois Indiana Kansas Kentucky ... Contents The Williamsburg Area Washington West Virginia State Parks Wisconsin Wyoming Grand Teton/Jackson Hole Area Canada Alberta Kananaskis Village British Columbia Whistler Mountain Manitoba ... Manitoba New Brunswick Nova Scotia Ontario Prince Edward Island Quebec The Caribbean The Bahamas Grand Bahama Island Nassau Barbados Bermuda Cayman Islands Dominican Republic Jamaica Puerto Rico...
- 557
- 343
- 0
Báo cáo y học: "Liver sinusoidal endothelial cells represents an important blood clearance system in pigs" doc
Ngày tải lên :
13/08/2014, 13:20
... formaldehyde-treated serum albumin (FSA) and α-mannosidase The circulatory survival of FSA and α-mannosidase was determined after intravenous administration of trace amounts of 125I-tyramine ... we also developed a method for mass isolation and culture of pig LSEC Rate of elimination and organ distribution of FSA and αmannosidase First we studied the circulatory survival and anatomical ... ethanol, and finally in PBS to remove unbound TRITC Determination of anatomical distribution and serum t1/2 Serum half-life and organ distribution of intravenously administered radiolabeled FSA...
- 14
- 179
- 0
DSpace at VNU: Ho Chi Minh thought: An important contribution to the field of comparative political thought
Ngày tải lên :
16/12/2017, 12:43
... discourses in the West (Pankaj Mishra, Narayana Rao, Sanjay Subrahmanyam, and David Shulman) These have a distinct quality o f their own, as Shulman (2012) distinguishes between “the emergent indigenous ... such as international state-building and “regime change,” have pierced the veil of sovereignty, reflecting continued resistance by Western actors to any conception of self-determination as an unqualified ... elimination o f “barbaric custom s” (Permanent M andates Commission re: “Social, Moral, and Material Conditions o f the N atives”) As a result o f these mandates, European companies significantly...
- 13
- 90
- 0