cheesy plaques and fungal growth in the lungs and air sacs of a bird with aspergillosis
studies of pathogenesis-related proteins in the strawberry plant partial purification of a chitinase-containing protein complex and analysis of an osmotin-like protein gene
... glycosylation and prolyl-hydroxylation As demonstrated in other PR protein families, there are acidic and basic isoforms of chitinases Basic chitinases are usually in the vacuole and have antifungal ... organism (Ponath et al., 2000) A class III chitinase in Vitis vinifera was first induced in the leaf inoculated with Plasmopara viticola, and induced later in the upper-stage healthy leaf; in ... involved in the feedback regulation of SA biosynthesis during SAR (Cao et al., 1997) NPR1 is an ankyrin-repeat containing protein, a domain often involved in protein-protein interactions A subclass of...
- 119
- 307
- 0
Symptomatology of Gynecological Malignancies: Experiences in the Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India pot
... malignancies and health care seeking behavior of the patients Analysis of Data Data obtained were collated and analyzed statistically by simple proportions and tests of significance (chi-square test), as ... ovarian malignancy (23.9%) Contribution of other malignancies was endometrial malignancy and gestational trophoblastic neoplasia in 5.3% of the patients each However, vulval malignancy and vaginal ... carcinoma of the ovary (20.3%), carcinoma of corpus uteri (6.5%), carcinoma of the vulva (5%), choriocarcinoma (4.7%) and carcinoma of the vagina (1.2%) Chhabra et al (2002) observed in a study...
- 7
- 321
- 0
Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx
... and mutagenic changes are shown in bold) BPL-for, 5¢-TTCTTAACCATGG GCTTCAAAAACCTGAT-CTGG-3¢; BPL-rev, 5¢-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢; BCCPD67, 5¢-GTAACCATGGGTGAACAGGAAGA A- 3¢; BCCP-rev, ... preincubation with biotin and biotin and ATP Taken together these results suggest that the binding of the substrates and/ or the formation of the intermediate, biotinyl-5¢-AMP, plays a role in protecting ... both in the absence and presence of saturating amounts of biotin and MgATP (Fig 5C) This demonstrates that the active lysine residue does not take part in the cross-linking reaction and saturating...
- 11
- 578
- 0
From Privilege to Competition - Unlocking Private-Led Growth in the Middle East and North Africa pot
... Business data generally refer to a formal manufacturing firm in the capital city The report draws on a variety of data sources, including international databases, country-specific databases and reports, ... policy chapter), and Mehdi Benyagoub, Manuela Chiapparino, Sylvie Maalouf, Yasmine Rouai, and Jimena Zuniga (research assistance and data analysis) Sydnella Kpundeh was the team assistant throughout ... delve into these specifics The lack of data availability in this area not only pertains to the diversity and scope of the private sector, it also reflects a fundamental weakness in the statistical...
- 278
- 478
- 0
Fertility of Men and Women Aged 15–44 Years in the United States: National Survey of Family Growth, 2006–2010 docx
... parental living arrangements in adolescence, and Hispanic origin and race Age of respondent, marital status, and educational attainment reflect status at the time of the interview Educational attainment ... report information about the fathers of their babies, and if they do, their reports of the father’s age and other characteristics may not be accurate Father’s age as shown in this table for the ... include the educational attainment of the respondent’s mother and parental living arrangements at age 14 The definition of Hispanic origin and race used in this report takes into account the reporting...
- 29
- 756
- 0
Báo cáo sinh học: " Vascular endothelial growth factor regulates melanoma cell adhesion and growth in the bone marrow" ppt
... most of human epithelium-derived malignant tumors and plays a role in their growth [18-20] and metastases [21] Human melanoma, a non-epithelial tumor characterized by a marked inflammatory stromal ... temperature of 25°C, and the anterior chest wall was shaved and prepared for aseptic surgery by washing with iodine and 70% ethanol The ribs over the heart were exposed, and a 30-gauge needle attached ... cell line Clin Exp Metastasis 1999, 17:687-694 17 Ono K, Akatsu T, Murakami T, Kitamura R, Yamamoto M, Shinomiya N, Rokutanda M, Sasaki T, Amizka N, Ozawa H, Nagata N, Kugai N: Involvement of cyclo-oxygenase-2...
- 14
- 393
- 0
Báo cáo y học: "Cytokine & chemokine response in the lungs, pleural fluid and serum in thoracic surgery using one-lung ventilatio" pps
... processing the samples and critically reviewed the manuscript; DL performed the pleural lavages and the surgery, was involved in the statistical analysis and the drafting of the manuscript; DO was involved ... pleural fluid samples on the day of surgery and on day 1-3 Again, the samples were processed as described Cytokine assays The concentrations of IL-6, IL-1RA and GROα in the BAL, pleural space and ... M, Nakajima Y, Kanehiro H, Watanabe A, Ohyama T, Nishio K, Sho M, Nagao M, Harada A, Matsushima K, Nakano H Serum interleukin-6, interleukin-8, hepatocyte growth factor, and nitric oxide changes...
- 26
- 369
- 0
Báo cáo y học: "Phenotypical and functional characterization of alveolar macrophage subpopulations in the lungs of NO2-exposed rats" pot
... of and designed the study, was involved in animal exposure and cell preparation, performed FACS analysis and drafted the manuscript AS was involved in animal exposure and cell preparation, carried ... macrophage-derived mediators that are involved in the regulation of inflammatory responses Therefore, ED7+ and ED7- AM of the rat were separated from the lungs of days exposed animals Total RNA was ... may also cause changes in lung function such as limitation of airflow and increased expiration time that are indicative for the occurrence of airway obstruction [23] and may finally even lead...
- 11
- 365
- 0
Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx
... intravascular 67Ga radioactivity The PLI represents the transport rate of 67Ga-transferrin from the intravascular to the extravascular spaces in the lungs, and it is therefore a measure of pulmonary capillary ... is indicative of prior HSV-1 infection By taking pulmonary blood volume and thus presumably surface area into account, the radioactivity ratio represents the ratio of extravascular to intravascular ... differentiate between symptomatic and asymptomatic viral shedding and spread, which could inform the decision regarding whether to institute antiviral therapy and help in determining the pathogenicity...
- 6
- 284
- 0
Does a Causal Link Exist between Foreign Direct Investment and Economic Growth in the Asian NIEs
... the causal links between FDI and GDP and the causality of these two variables by looking at a sample of 31 developing counties in Asia, Latin America, and Africa for the period of 1970-2000 They ... Malaysia, Thailand, and the Philippines, this paper tests the causal relationship between the two variables of GDP growth and FDI inflow Data for Thailand, Indonesia, Malaysia, and the Philippines ... for these tests are GDP annual growth rate and FDI net inflows as a percentage of GDP with and without Export of goods and services as a percentage of GDP Looking at Singapore, Indonesia, Malaysia,...
- 37
- 358
- 0
Entrepreneurship and enterprises growth in the industrialization of private sector evidence from wenzhou
... out by Praag et al (2005), using personal asset as a measure of initial capital constraint ignored the possibility of obtaining external finance, the chances of resorting to financial institutions ... “inside entrepreneurs” who follow the goal of the organization: while operating within the organizational environment, they focus on innovation and creativity, and transform an idea into a profitable ... constraint Start-up capital (initial asset of the firm), which is a function of a few factors including both initial personal wealth and financing channels (Colombo and Grilli (2005)), represents the...
- 89
- 416
- 0
Financial Development and Growth in the Short and LongRun
... Rajan and Zingales (1998) Fraction Industry's share of total value added in manufacturing in 1980 from Rajan and Zingales (1998) Share of trade with the US as a fraction of total output in each ... Germany Greece India Indonesia Israel Italy Jamaica Japan Jordan Kenya Korea, Rep Malaysia Mexico Morocco Netherlands New Zealand Norway Pakistan Peru Philippines Portugal Singapore South Africa ... calculated using U.S data (obtained from the Compustat database) The original measure is calculated as a ratio of investment minus cash flow divided by investment and captures the percentage of...
- 28
- 550
- 0
Tài liệu Health and Safety in the Child Care Setting: Prevention of Infectious Disease pdf
... containers within reach of the diaper changing area, hand washing sink, and food preparation area • Remove, clean and sanitize containers from children’s area daily • Make sure that infants and ... with a dry, clean bandage Having hand lotion at the sink for staff who must frequently wash their hands is a good way to prevent skin dryness and cracking When assisting a child in hand washing, ... pedal Frequent hand washing can worsen sores and cuts on the hands or cause cracked, dry skin These areas are hard to clean and can contain germs Cuts should be washed well with soap and water and...
- 171
- 590
- 0
Tài liệu The Kafia Kingi Enclave - People, Politics and History in the North-south Boundary Zone of Western Sudan doc
... Umbelacha area explained places where Binga people belong: ‘Binga places: Garsila, Chad, Sungo, Kafindebi, Minamba, Kafia Kingi, al-Fashir The sultan of the Binga—Sultan Dahia in Minamba He is the ... as a lingua franca, and where some groups had adopted Islam The British razed the town of Kafia Kingi, and turned the borderlands between Raga and Darfur into a no man’s land For financial reasons, ... has a document from the English times In Buram, in Habbaniya areas, they have an umda They have shaykhs in Gar Sila and Nyala In Fashir they follow the Fur They don’t have shaykhs… Binga in al-Fashir...
- 171
- 444
- 0
Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf
... and Biostatistical Activity (PASBA) also made a major contribution to the evaluation by generating the administrative data for the analysis of the effects of guideline implementation Their careful ... Administration Systems and Biostatistical Activity Primary care manager Pharmacoeconomic Center Patient-Level Cost Allocation Quality management Standard Ambulatory Data Record Standard Inpatient Data ... guidelines to achieve best practices that reduce variation and enhance quality of medical care With the goal of establishing such a system, the AMEDD contracted with RAND to work as a partner in the...
- 212
- 442
- 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx
... Furthermore, these data may be of particular importance in understanding the physiological role of b-glycosidases and in designing inhibitors In addition, another important issue in understanding the aglycone ... F Mendonca and S R Marana ¸ Following the characterization of the binding of different types of aglycone, a comparative analysis of the mutational effect on their binding revealed that residues ... gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢...
- 12
- 731
- 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... Gramnegative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1) Parabutoporin inhibits the growth of all Gram-negative bacteria ... amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the opistoporins ... peptide may interact with the negative charges on the LPS of Gramnegative bacteria, enabling the disruption of the outer membrane and facilitating the interaction of the toxin with the inner membrane...
- 12
- 598
- 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx
... glutamate (in yeast or humans) may affect the structure of the hinge region, resulting in a hindered movement and enzyme instability As suggested previously for a yeast mutant with a + alanine insertion ... inhibited the activity in samples from the patient This was in agreement with the data obtained in this study, using the mutant yeast enzyme It has been reported that a mutation in the hinge region of ... would, in turn, alter the catalytic activity of the complex The mutation could also affect the binding of the ISP to the bc1 complex and distort the Qo site Our data showed that, in the mutant, the...
- 7
- 498
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... Vpr was fused in- frame with a Gal4 DNA-binding domain and used as bait in the yeast expression vector pGBT9 The GAL-4 activation domain tagged brain cDNA library (gift from Dr Srinivasan, Thomas ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
- 12
- 561
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25