check that a wnv route exists on each host for each subnet in the virtual machine network
Health services research on endoscopic surveillance for gastric cancer in the singapore chinese population experience of the gastric cancer epidemiology clinical and genetic program
... 2001) The mutation responsible for familial adenomatous polyposis is associated with antral adenocarcinoma in Japanese and Korean populations 1.5 Clinical Management and Clinical Outcomes of Gastric ... long preclinical phase provides adequate time for clinical intervention There is data to support the idea that a long clinical phase is associated with a long preclinical phase and verse versa ... have started clinical applications in recent years (Wang et al 2012) For advanced GC cases, systemic medical management remains the mainstay Besides traditional chemotherapy, various immunotherapeutic...
- 201
- 335
- 0
A discussion proposal on people''''s adaptability to floods in the Mekong river delta
... implemented in AnGiang, DongThap and LongAn, almost the farmers said that “Living with flood” or “Shaking hands with flood” as the best way for the Mekong Delta sustainable development IV DISCUSSION In ... forecast the relation between the warm atmosphere and the storms in the tropical monsoon Asia Survey and forecast the effects of the dams and irrigation systems in upstream to the low parts of the basin ... such as pumping stations, irrigation and drainage canal systems, crop protection dikes and dams have been built in the Mekong Delta Almost these water works were investigated by the national budget...
- 2
- 481
- 0
UNLOCKING FOREST BONDS A HIGH-LEVEL WORKSHOP ON INNOVATIVE FINANCE FOR TROPICAL FORESTS docx
... defor- estation In addition to payments for forest carbon, other payments for reductions in deforestation and unsustainable land use are emerging Achieving sustainable land ... climate change and forest own policies for maintaining their natural capital These state-level initiatives provide lessons and models upon which national and international ... Guarantees Guarantors insure against default of a bond (or other debt payback) for any reason +++ +++ +++ Commercial Insurance Insure against losses due to specific risk events, such as natural...
- 28
- 312
- 0
báo cáo hóa học:" Double disadvantage: a case control study on health-related quality of life in children with sickle cell disease" potx
... was used to manage and analyze the data First, missing values were handled according to the guidelines given in the manual of the KIDSCREEN-52 The percentage of missing data was
- 8
- 466
- 0
Báo cáo toán học: " A virtual infrastructure based on honeycomb tessellation for data dissemination in multi-sink mobile wireless sensor networks" pot
... all of the generated data in the network and permits the performing of certain data optimizations (e.g., data aggregation) before sending the data to the destination sink [6] Second, in WSNs ... cell In RailRoad and LBDD, the rendezvous region is divided into smaller subregions called station All the nodes in a station are informed about the data but one of them forwards data towards sink ... the sink using GF Using a line as rendezvous area at the middle of the network can results in high latency for the nodes near the boundary of the network RailRoad [12] places a virtual rail in...
- 72
- 457
- 0
Báo cáo y học: "Hallux valgus and hallux rigidus: a comparison of impact on health-related quality of life in patients presenting to foot surgeons in Australia" doc
... acknowledge the Australian Podiatry Education and Research Foundation for a research grant that assisted this project – the funding body had no input into the design; in the collection, analysis, and interpretation ... interpretation of data; in the writing of the manuscript; and in the decision to submit the manuscript for publication We also gratefully acknowledge the surgeons that participated in data collection ... et al 1977 Stage Lateral displacement of the great toe (hallux) at the metatarsophalangeal joint Minimal sesamoid displacement Stage Hallux abductus deformity (great toe pressing against the...
- 6
- 383
- 0
báo cáo khoa học: " A var2 leaf variegation suppressor locus, SUPPRESSOR OF VARIEGATION3, encodes a putative chloroplast translation elongation factor that is important for chloroplast development in the cold" docx
... many domains in common A GTP binding domain (Domain I) is present in all factors, while TypA, LepA and EF-G share an additional three domains (Domains II, III and V) [39,40] EF-G contains a unique ... LepA and TypA share a similar arrangement of functional domains, especially the latter three, which share domains I, II, III and V and each also contains a unique domain (Figure 4A) Crystal structures ... facilitate different roles in translation In the case of SVR3/AtcpTypA, the C-terminal domain may play a crucial role in mediating specific interactions between TypA and the ribosome at chilling...
- 18
- 554
- 0
báo cáo khoa học: " A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1" ppsx
... ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtccggg), with capitals indicating ERS1 sequence and parentheses indicating T-DNA left border sequence This mutation was named ers1-3 to differentiate it ... insertion, and ETR1-3'F (5' CATACCGAAAGTTCCAGCCATTC 3') and ETR1-3'R (5' CAAGCATCCATAACTCGATCCAAATTC 3') for amplification of a product 3' to the site of the T-DNA insertion After 25 cycles, the ... from the Arabidopsis Knockout Facility [20] A line was identified that contained a T-DNA insertion within the first exon of ERS1 (Fig 1A) Sequence at the T-DNA junction with ERS1 was ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtccggg),...
- 15
- 393
- 0
Báo cáo sinh học: "A robust approach based on Weibull distribution for clustering gene expression data" pps
... cluster After calculating the BP annotation ratios for all clusters, we treat the mean value of all annotation ratios as the final BP annotation ratio We also define the CC and MF annotation ratios ... comparative analyses on the functional annotation ratios of the three algorithms have demonstrated that the genes in each cluster obtained using the WDCM show not only the similar expression patterns, ... cancer and follicular lymphoma data sets The detailed comparisons for the lung cancer data set are given in Figure 4A, from which we found that the three final functional annotation ratios of the...
- 9
- 425
- 0
Báo cáo y học: "Soluble triggering receptor on myeloid cells-1 is expressed in the course of non-infectious inflammation after traumatic lung contusion: a prospective cohort study" pptx
... Increased sTREM-1 levels could also be explained by bacterial contamination or infection (that is, aspiration on scene) We therefore excluded the BALs of patients positive for intracellular organisms, ... tissue macrophages [9] The resulting self-propagating inflammation within the alveolar space might cause devastating lung injury and is associated with a significant mortality Given the role ... sTREM-1 as a biological marker for an inflammatory response within the lung, we pursued the hypothesis that the inflammation induced by severe trauma might lead to the expression of sTREM-1 within...
- 7
- 455
- 0
Báo cáo sinh học: " A note on mate allocation for dominance handling in genomic selection" doc
... ( Aa ) d j − prijk ( aa ) g j ⎤ ⎦ where pr ijk (AA), pr ijk (Aa) and pr ijk (aa) are the probabilities of the genotypes AA, Aa and aa for the combination of the ith and jth individual and the ... Spain 2Facultad de Veterinaria, Universidad de Zaragoza, 50013 Zaragoza, Spain Authors’ contributions LV wrote the main computer programs and ran them Both authors wrote and approved the final ... is the number of SNP and x ij are indicator functions that take the values 1, 0, -1 for the SNP genotypes AA, Aa and aa at each loci, respectively The assumed distributions for each additive a...
- 9
- 202
- 0
a study on theme-rheme and cohesive ties in the short story the last leaf” by o’henry nghiên cứu về tổ chức đề thuyết và các mối liên kết trong truyện ngắn chiếc lá cuối cùng của o’henry
... the contrary, instead), subtractive (apart from that, except for that) , and alternative (alternatively) Halliday (1994) also states that in enhancement, one clause enhances the meaning of another ... fundamental functions of language into three broad metafunctions: ideational, interpersonal and textual Each functional component corresponds to each parameter register as the working hypothesis: ... information in a text, and is concerned with clauses as messages The textual metafunction acts to organize the flow of interpersonal and ideational meanings as they unfold in a text The textual...
- 96
- 1,249
- 6
A study on Theme-rheme and cohesive ties in the short story The last leaf by O’Henry
... Linguistics.Wellington: Continuum Wellington House Halliday, M .A. K (1994) An Introduction to Functional Grammar Second Edition, London: Edward Arnold Halliday, M .A. K & Hasan, R (1985) Language, Context and ... the description of the main areas of functional grammar and the latter deals with the analysis of the text for discussion 1.5 Data collection The text is taken from one of the most famous short ... related to 1) Interpersonal meanings, which focus on the social function of language, more specifically, the participants; 2) Ideational meanings, focusing on how language is used, that is, the...
- 5
- 1,206
- 19
Tài liệu A Women’s Health Intervention for Gynecological Problems in the Deployed Environment ppt
... of “make shift measures” to urinate • Dehydration (not drinking fluids to prevent urination) Vaginal symptoms: Itching, burning, pain, & discharge Menstrual complaints: Pain, heavy bleeding, ... recognize the impact of the deployed environment on feminine health and hygiene Preventive measures to avoid vaginal infections, urinary tract i f i infections, (UTIs) and menstrual symptoms are not ... Does providing women with information on feminine • hygiene and menstrual self-care practices lead to a decrease in genitourinary complaints during deployment? Specific Aims To increase knowledge...
- 18
- 734
- 0
Báo cáo " A new Environmental Poverty Index (EPI) for monitoring system in the SEA (Strategic Environmental Assessement) procedure " docx
... in Asia and the Pacific is increasingly concentrated in the places with harsh living conditions, including marginal land, depleted resources, pollution, congestion, and proneness to natural and ... ADB assumes that in certain rural locations, the primary reason for an inability to escape poverty has to with the natural environment For example, assessments of the poor living in dryland areas ... areas may conclude that the main reasons for their persistent poverty are marginal land and a lack of access to water This does not mean unawareing that the poverty has multiple causes, often including...
- 9
- 352
- 0
A Knowledge-Based Approach to Network Security: Applying Cyc in the Domain of Network Risk Assessment pptx
... that gathers information about the software, hardware and status of the machine it is running on The server polls the Sentinels, gathers network information from them, and then represents that ... indicates it is a specialization of ConceptualWork, the collection of deliberately created things that lack a location in space but have a beginning in time and an associated abstract information ... that information in the KB 2.3 CycSecure Software Components CycSecure Sentinels and Server The Sentinels are small software daemons that run on each machine on the target network They are designed...
- 6
- 490
- 0
Báo cáo khoa học: "SITS: A Hierarchical Nonparametric Model using Speaker Identity for Topic Segmentation in Multiparty Conversations" pptx
... cluding political debates, business meetings, and online chats More formally, such datasets contain C conversations A conversation c has Tc turns, each of which is a maximal uninterrupted utterance ... not appear in the corresponding question This results in a set of non-binary reference segmentations For evaluation metrics that require binary segmentations, we create a binary segmentation by ... probability that the speaker m will change the topic (distribution) of a conversation We take a Bayesian nonparametric approach (M¨ ller and Quintana, 2004) Unlike u 2.1 Note the distinction with phonetic...
- 10
- 555
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25