certification protocol of a loco regional breast screening programme
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new ... CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA...
- 14
- 473
- 0
báo cáo hóa học: " Tobacco smoke particles and indoor air quality (ToPIQ) - the protocol of a new study" potx
... ML, Pham L, McDermott A, Zeger SL, Samet JM: Fine particulate air pollution and hospital admission for cardiovascular and respiratory diseases Jama-Journal of the American Medical Association ... Following data processing, an exploratory data analysis will be carried out Data processing and analysis will be performed using specific calculating and statistical software Discussion So far, large ... Pope CA, Brook JR, Bhatnagar A, Diez-Roux AV, Holguin F, Hong YL, Luepker RV, Mittleman MA, et al: Particulate Matter Air Pollution and Cardiovascular Disease An Update to the Scientific Statement...
- 18
- 462
- 0
Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf
... no professional input They can be used as stand-alone interventions or as an adjunct to other forms of intervention This is a rapidly growing area and a recent meta-analysis of studies evaluating ... conclusions can be drawn regarding effectiveness [11] We are not aware of any studies which have systematically evaluated the use of a supported self-management approach for relatives of people with ... Care Coordinators or self-referral Potential participants are contacted by a research assistant (RA1) who presents them with verbal and written information about the Lobban et al BMC Psychiatry...
- 7
- 305
- 0
Báo cáo y học: " REFLEX, a social-cognitive group treatment to improve insight in schizophrenia: study protocol of a multi-center RCT" pptx
... trial aiming to evaluate the efficacy of REFLEX Research aims Main aim of the study is to evaluate the efficacy of REFLEX Primary outcome measures in this evaluation are the preconditions of ... scale consists of 20 Likert-scale items Perspective-taking The Theory of Mind subscale of the Davos Assessment of Cognitieve Biases Schaal (DACOBS) [Van der Gaag, Schütz, Ten Napel, Landa, Delaspaul, ... self-experience in narratives of schizophrenia Psychiatry Research 2008, 157:31-38 33 Holma J, Aaltonen J: Narrative understanding in acute psychosis Contemporary Family Therapy: An International Journal 1998,...
- 9
- 511
- 0
Báo cáo y học: " Disrupting the rhythm of depression: design and protocol of a randomized controlled trial on preventing relapse using brief cognitive therapy with or without antidepressants" pptx
... Mixed-model analysis of covariance (ANCOVA) will be used for the quantitative measures As covariates we shall use the stratification variables (number of episodes and type of aftercare and treatment ... regression analysis (survival analysis) will be performed, including as covariates the stratification variables that will be used in randomization, and additional variables, i.e.: number of previous ... Chatterji S, Aguilar-Gaxiola S, Alonso J, Angermeyer MC, Bromet EJ, Burger H, Demyttenaere K, de Girolamo G, Haro JM, Hwang I, Karam E, Kawakami N, Lépine JP, Medina-Mora ME, Posada-Villa J, Sampson...
- 9
- 350
- 0
Báo cáo y học: " Correction: Folate Augmentation of Treatment – Evaluation for Depression (FolATED): protocol of a randomised controlled trial" potx
... now reads "We shall compare folic acid and placebo using analysis of covariance to take account of baseline differences, notably in folate levels and the prescription of lithium." 2) We have removed ... had intended the FolATED trial to be paperless, we have replaced the electronic trial database by a rigorous paper-based data collection system We have therefore amended the section on data handling ... electronically Electronic data will be stored on a central computer at each centre Field investigators will use laptops that will be cleared of data after every visit once uploaded to the central database...
- 2
- 278
- 0
Báo cáo y học: " G-CSF and IL-8 for early diagnosis of sepsis in neonates and critically ill children – safety and cost effectiveness of a new laboratory prediction model: study protocol of a randomized controlled trial [ISRCTN91123847]" pps
... plasma measurements of IL-8 and G-CSF and tracheal aspirate levels of G-CSF, employing a new laboratory method that allows simultaneous determination of parameters from 50 µl blood or tracheal ... Clinical data record form A trained study nurse collects all relevant clinical data for the day before and until days after collection of blood and/or form tracheal aspirate for microbiological examination ... patient baseline data, routine laboratory results, pharmacology data, costs per R446 patient and day of specific medications (e.g fresh frozen plasma), and staff allocation Cytokine measurement...
- 8
- 407
- 0
Báo cáo khoa học: "Surgical outcomes of borderline breast lesions detected by needle biopsy in a breast screening program" ppsx
... perspective All authors read and approved the final manuscript Authors’ information KMF has been a breast physician since 1989 and is a Fellow of the Australasian Society of Breast Physicians AMB is ... Woden, ACT, 2606, Australia 2BreastScreen ACT&SENSW Moore Street, Canberra, ACT, 0200, Australia 3The Canberra Hospital, Woden, ACT, 2606, Australia Page of Authors’ contributions KMF and AMB conceived ... References Australian Institute of Health and Welfare: BreastScreen Australia Monitoring Report 2002-2003 Canberra, ACT, Australia: AIHW 2006 Jacobs TW, Connolly JL, Schnitt SJ: Nonmalignant lesions...
- 6
- 367
- 0
Báo cáo y học: " Protocol for a randomised controlled trial of risk screening and early intervention comparing childand family-focused cognitive-behavioural therapy for PTSD in children following accidental injury" pot
... approach; is age appropriate, incorporates creative drawing and writing tasks and aims to: provide psychoeducation about the role of thoughts, behaviours (avoidance) & physical reactions in anxiety ... waitlist and active treatments For the evaluation of diagnostic change (e.g whether children became free of their PTSD diagnosis), and accounting for an attrition rate of approximately 20%, a ... Journal of Traumatic Stress 2002, 15:99-112 Berry JG, Harrison JE: Serious injury due to land transport accidents, Australia, 2003-04: AIHW cat no INJCAT 107 Canberra: AIHW & ATSB; 2007 Kahana SY,...
- 9
- 696
- 0
Báo cáo y học: " Protocol for a randomised controlled trial of risk screening and early intervention comparing childand family-focused cognitive-behavioural therapy for PTSD in children following accidental injury" pptx
... Annerley Road, South Brisbane QLD 4101, Australia 4School of Psychology, Flinders University, Adelaide SA 5001, Australia Received: 19 January 2011 Accepted: 20 January 2011 Published: 20 January 2011 ... University of Queensland, Herston QLD 4029, Australia School of Psychology, University of Queensland, St Lucia QLD 4072, Australia 3Child and Youth Mental Health Service, Mater Children’s Hospital, Annerley ... Cite this article as: Kenardy et al.: Protocol for a randomised controlled trial of risk screening and early intervention comparing child- and family-focused cognitive-behavioural therapy for PTSD...
- 2
- 366
- 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management ... and biodiversity are most threatened values Amount of commercial shipping and number of trading partners affecting pathway strength A limited number of IMP have been identified in APEC Management...
- 10
- 583
- 0
Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc
... stream! UDT – UDP-based Data Transfer Protocol • Application level transport protocol built above UDP • Reliable data delivery • End-to-end approach • Bi-directional • General transport API; ... avoidance Overlapped IO Data scattering/gathering Speculation of next packet User Buffer Data Protocol Buffer Protocol Buffer New Data API • Socket-like API • Support overlapped IO • File transfer ... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity...
- 32
- 580
- 0
Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf
... technical learning ability of the economy in a period of radical technical change They concluded that the capability of national economies to learn abou, adapt and change their instiutional frameworks ... the natural geographical unit because the policies and programmes of national government, the laws of a nation, and the existence of a common language and shared cultural identity define an inside ... systems of innovation are increasingly being framed within an international arena The links between sub -regional, regional, national and international systems of innovations imply hat analyses...
- 180
- 596
- 1
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
... demographic and socioeconomic variables such as age, education, marital status, and employment status, and clinical variables such as cancer stage at diagnosis, time after diagnosis, and initial ... information that is congruent with a patient’s needs at that particular time is an important determinant for patient satisfaction and affects health-related quality of life (HRQoL) and anxiety and ... usual care group with that of the SCP approach by giving a patient randomized to usual care more information than was intended for usual care Also, if usual care patients learn from other patients...
- 8
- 786
- 0
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... folded GABARAP [22] The addition of CRT to GABARAP resulted in the disappearance of GABARAP resonances, a clear indication of binding (Fig 3B) Only weak amide signals for a Gln ⁄ Asn side chain and ... et al (2001) Functional specialization of calreticulin domains J Cell Biol 154, 961–972 Harada K, Takeuchi H, Oike M, Matsuda M, Kanematsu T, Yagisawa H, Nakayama K-II, Maeda K, Erneux C & Hirata ... interact with CRT By contrast with GABARAP, no quantitative data are available for these interactions Most importantly, the interaction of CRT with GABARAP occurs with natively folded GABARAP This...
- 13
- 560
- 0
Cervical Cancer Screening In Developing Countries - Report Of A WHO Consultation doc
... the early diagnosis of high-grade cervical intraepithelial neoplasia and early preclinical, asymptomatic invasive cancer A major advantage with VIA is that it is a real-time screening test, as ... retraining are ideal Participation of the laboratory in an external quality control programme, such as that organized by the Pan-American Health Organization (PAHO) for many Latin American countries ... qualifications similar to those defined for National Cancer Control Programmes coordinators (6) Management Management of all phases of the programme is also critical Programmes often fail because an...
- 89
- 1,137
- 0
Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot
... Ecuador El Salvador Granada Guatemala Guyana Haití Honduras Jamaica México Nicaragua Panamá Paraguay Perú República Dominicana Saint Kitts y Nevis San Vicente y las Granadinas Santa Luc a Surinam ... PAÍSES INDUSTRIALIZADOS Alemania Andorra Australia Austria Bélgica Canadá Chipre Dinamarca Eslovaquia Eslovenia Espa a Estados Unidos Estonia Finlandia Francia Grecia Hungr a Irlanda Islandia ... sistemas no dan abasto debido al SIDA y a la mortalidad asociada esta enfermedad En última instancia, aunque las causas de la mortalidad materna y de las lesiones y discapacidades relacionadas el...
- 48
- 417
- 0
Cervical Cancer Screening in Developing Countries: Report of a WHO consultation doc
... the early diagnosis of high-grade cervical intraepithelial neoplasia and early preclinical, asymptomatic invasive cancer A major advantage with VIA is that it is a real-time screening test, as ... retraining are ideal Participation of the laboratory in an external quality control programme, such as that organized by the Pan-American Health Organization (PAHO) for many Latin American countries ... qualifications similar to those defined for National Cancer Control Programmes coordinators (6) Management Management of all phases of the programme is also critical Programmes often fail because an...
- 89
- 848
- 0
báo cáo hóa học:" Development and validation of a psychosocial screening instrument for cancer" potx
... of validity Finally, raw means and standard deviations are provided for each cancer type and each gender group (Table 4) This presentational approach appeared more parsimonious and provided a ... initial data for a 3-month time period rather than setting a particular sample size as a target; the rationale for this decision was to allow us later determination what percentage of the total ... logical organization than a mere sequential listing of each temporal step of the result finding process As the mean scores in Table show, indices of variability reveal that participants used a wide...
- 7
- 463
- 0
báo cáo hóa học:" Heath-related quality of life in Spanish breast cancer patients: a systematic review" pptx
... R, Tobalina MC, Vidal E, Marcos-Gragera R, Mateos A, Garau I, Rojas-Martin MD, Jimenez R, Torrella-Ramos A, Perucha J, Perez-de Rada ME, Gonzalez S, Rabanaque MJ, Borras J, Navarro C, Hernandez ... termination of adjuvant treatments Arraras et al [31] 2008 To make a prospective assessment of the QL of elderly patients who initiated treatment with radiotherapy, and compare it with that of a sample ... Valoración subjetiva de la calidad de vida en pacientes cáncer de mama metastásico durante el tratamiento quimioterapia Clin Salud 1995, 6:83-92 31 Arraras JI, Manterola A, Domínguez MA, Arias...
- 10
- 479
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008