cellular molecular and biological insight into chemopreventive and therapeutic potential of 3 3 apos diindolylmethane dim
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
Ngày tải lên :
18/06/2014, 22:20
... Page 14 of 15 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 dependent modulation of Th1 and Th2 responses to immunization with beta-amyloid Int Immunol 20 03, 15:505-514 ... against H1 or H3 serotype influenza viruses Vaccine 2008, 26 :36 26 -36 33 30 Dickey CA, Morgan DG, Kudchodkar S, Weiner DB, Bai Y, Cao C, Gordon MN, Ugen KE: Duration and specificity of humoral immune ... Care and Use Committee of UCI and were in accordance with the guidelines of the National Institutes of Health Page of 15 viruses was confirmed by RT-PCR and restriction/ sequence analysis of the...
- 15
- 431
- 0
Báo cáo toán học: "Adult neurogenesis, neuroinflammation and therapeutic potential of adult neural stem cells" ppsx
Ngày tải lên :
08/08/2014, 17:20
... one hand, it may limit the therapeutic potential of adult NSCs in vivo and ex vivo On the other hand, it may interact with the neurogenic niches to promote the regenerative potential in vivo, and ... Brain Res Brain Res Rev 2005; 48: 38 8-99 [3] Stoll G, Jander S The role of microglia and macrophages in the pathophysiology of the CNS Prog Neurobiol 1999; 58: 233 -47 [4] Streit WJ, Walter SA, Pennell ... in a broad range of neurological diseases and disorders (fig 1) The contribution and significance of this modulation to the etiology and pathogenesis of neurological diseases and disorders remain...
- 6
- 232
- 0
Prophylactic and therapeutic potential of synthetic peptides against enterovirus 71
Ngày tải lên :
12/09/2015, 08:19
... probes 66 2 .3. 2 Design and synthesis of conjugated and unconjugated synthetic peptides 68 2 .3. 3 RNA work 68 2 .3. 3.1 Total RNA extraction 68 2 .3. 3.2 Viral genomic RNA extraction 69 2 .3. 3 .3 Conventional ... subgenogroups and outbreak occurrence 14 1 .3. 3 Clinical features of diseases caused by enterovirus 71 (EV71) 19 1 .3. 3.1 Hand, foot and mouth disease (HFMD) 19 1 .3. 3.2 Other EV71-associated diseases 22 1 .3. 4 ... 2.2.2 .3 2 .3 In vitro culturing and activation of dendritic cells (DCs) 64 CD4+ T cell selection and proliferation 65 Molecular biology 66 2 .3. 1 Design and synthesis of EV71-specific primers and...
- 267
- 296
- 0
Báo cáo khóa học: Mechanistic insight into the peroxidase catalyzed nitration of tyrosine derivatives by nitrite and hydrogen peroxide doc
Ngày tải lên :
16/03/2014, 16:20
... (2000) Properties and reactivity of myoglobin 906 E Monzani et al (Eur J Biochem 271) 31 32 33 34 35 36 37 38 reconstituted with chemically modied protohemin complexes Biochemistry 39 , 95719582 Redaelli, ... times of and were 11.5 and 12.7 min, respectively, and those of the corresponding nitration products, 3- (4-hydroxy -3- nitrophenyl)-propionic acid and 4-hydroxy -3- nitrobenzonitrile, were 13. 9 and ... 2004 (a value of 13. 3 M)1ặs)1 was reported previously for this reaction at pH 7.0 [35 ]) Data on the rate of reduction of LPO compound II [36 ] and HRP compound II by several phenols [37 ,38 ] are available...
- 12
- 414
- 0
Báo cáo khoa học: Hodgkin Reed–Sternberg cells express 15-lipoxygenase-1 and are putative producers of eoxins in vivo Novel insight into the inflammatory features of classical Hodgkin lymphoma ppt
Ngày tải lên :
30/03/2014, 04:20
... cells and the cellular localization of the enzyme in the presence and absence of calcium, the 4224 Fig Western blot and assay of 15-LO-1 activity after subcellular fractionation of L1 236 cells ... 4 234 33 34 35 36 37 38 HE et al (1996) Peripheral blood mononuclear cells of a patient with advanced Hodgkin’s lymphoma give rise to permanently growing Hodgkin-Reed Sternberg cells Blood 87, 34 18 34 28 ... leukocytes J Biol Chem 267, 19 233 –19241 Ingram CD & Brash AR (1988) Characterization of HETEs and related conjugated dienes by UV spectroscopy Lipids 23, 34 0 34 4 Andersson E, Schain F, Svedling...
- 13
- 350
- 0
báo cáo khoa học: "Long-term exposure of CdTe quantum dots on PC12 cellular activity and the determination of optimum non-toxic concentrations for biological use" docx
Ngày tải lên :
11/08/2014, 00:22
... composition [33 -35 ], which has given genuine cause for concern due to their potential cytotoxicity [33 ,35 ,36 ] In an effort to combat this problem, much research has been conducted into the mechanisms ... structure and morphology of the two differently sized types of QDs (Figure 3) HRTEM images of the different sized QDs show the highly crystalline nature of both the gel and non-gel QDs (Figure 3) Lattice ... quenching of the emission properties of the QDs is common when recorded in the presence of biological media Previously, we have investigated the effect of QD and protein charge on QD spectra and cellular...
- 16
- 301
- 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf
Ngày tải lên :
21/02/2014, 00:20
... 852692), with an LID domain of 18 amino acids, while the other two genes (AL354 533 ) encode longer AKs Moreover, the AL354 533 and AQ 852692 isoforms lack the threonine 31 residue, which is replaced ... yeast Biochem J 32 9, 35 9 36 7 Fukami-Kobayashi, K., Nosaka, M., Nakazawa, A & Go, M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside ... characterization Materials and methods Materials Plasmids pGEM-3Zf(+) and pQE30 were from Promega and QIAGEN, respectively [32 P]dCTP[aP] (30 00 CiÆ mmol)1) was from DuPont-NEN Restriction enzymes and Taq DNA...
- 9
- 487
- 0
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx
Ngày tải lên :
07/03/2014, 15:20
... primers E3 and primer E30 (5¢-AAGA ATTCTTTCCCCCCAGCCACAG -3 ) and CRFR1e with primers E3 and primer E31 (5¢-AAGAATTCTTGCT GGACCACGAACCAGGT -3 ) Final PCR fragments were purified by GFX gel band purification ... E21 and E 23 and connected to CRFR1 (exons 1–4) by primers E3 and E 23 This fragment was slightly extended by primer E27 (5¢-GGTAGTGCACCTTGCTTTTTTTCTCTCCCCA3¢) and attached to another fragment of ... detection of an additional CRFR1e1 protein (band 10) with molecular mass of 20 kDa (Fig 2) Proteins with lower molecular mass than expected included band (39 kDa) for CRFR1f, band (34 kDa) for...
- 10
- 671
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
Ngày tải lên :
07/03/2014, 21:20
... Nucleic Acids Res 32 , D 134 –D 137 29 Blom N, Gammeltoft S & Brunak S (1999) Sequenceand structure-based prediction of eukaryotic protein phosphorylation sites J Mol Biol 294, 135 1– 136 2 30 Janket ML, ... (cAMP, PKC, and CK2), and the presence of nine potential myristoylation sites in the VBARP protein (Fig 2C) psort software predicted with high accuracy the subcellular localization of VBARP, and indicated ... 4095 Molecular characterization of ANKHD1 splice variant A B Fig Expression of VBARP isoforms in vitro and in vivo: (A) In vitro transcription ⁄ translation of VBARP-L and VBARP-S One microgram of...
- 12
- 561
- 0
Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx
Ngày tải lên :
30/03/2014, 03:20
... biological process of interest, allows genes to be ordered into pathways, and can provide important and novel mechanistic insights into the molecular structure and function of proteins In addition ... regulation of chloride transport Acta Physiol 187, 1 03 1 13 36 Gamba G (2005) Molecular physiology and pathophysiology of electroneutral cation-chloride cotransporters Physiol Rev 85, 4 23 4 93 Osmosensing ... Nakano K (1998) Molecular cloning and characterization of a novel Ste20-related protein kinase enriched in neurons and transporting epithelia Arch Biochem Biophys 35 5, 233 –240 34 Denton J, Nehrke...
- 8
- 495
- 1
Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx
Ngày tải lên :
31/03/2014, 21:21
... 18 83 NT NT 1 434 1000 NT NT 814 2050 1960 139 3 935 39 0 1915 + + NR NR NR + NR NR NR NR NR NR NR NR NR NR ±6 ± 21 ± 17 ± 69 ± 10 ± 73 ± 47 ± 23 ± 100 ± 19 ± 270 ± 21 ± 36 ± ± ± ± ± ± ± 32 75 33 ... trans -3- Hexenol Benzyl alcohol 1-Phenyl ethanol 2-Phenyl ethanol TR 38 3 12 63 131 0 ND 916 796 610 ND 1000 1400 1270 850 555 32 2 132 3 + + + + + + + + NR NR NR + + + + + ± 12 ± 35 ± 135 ± 35 ±4 ... 5¢-gcactgaagagcatccggtacttc -3 and act3¢: 5¢-TGGGCACGGAATCTCAGC(TC) -3 The PCR programme was one cycle of at 95 °C, 50 s at 58 °C, 30 s at 72 °C followed by N cycles of 30 s at 95 °C, 50 s at 58 °C, 30 s at 72 °C (N ¼ 31 ...
- 8
- 509
- 0
Báo cáo hóa học: " Molecular and macromolecular alterations of recombinant adenoviral vectors do not resolve changes in hepatic drug metabolism during infection" potx
Ngày tải lên :
20/06/2014, 01:20
... Elimination of innate immune responses and liver inflammation by http://www.virologyj.com/content/5/1/111 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 PEGylation of adenoviral ... 0.5 μl of reverse-transcription product, 0.1 mM of each primer and μl of QuantumRNA™ 18S internal standard (Ambion, Austin, TX) at a primer:competimer ratio of 4:6 for CYP 3A2 and 2C11 and 3: 7 for ... evidence of recovery in animals treated with WT (31 % of control) AdlacZ (37 %) and HDAd (29%) (Figure 1D, p ≤ 0.01) CYP3A2 activity was assessed by separation and quantification of the isoform-specific...
- 17
- 340
- 0
báo cáo khoa học: "Cellular transfer and AFM imaging of cancer cells using Bioimprint" pdf
Ngày tải lên :
11/08/2014, 00:22
... nature and response of cells, yielding insights into drug responses and effects Considerable variability in the sizes of dimple depressions and ruptures, as well as dynamic formation and grouping of ... Biotech 20 03, 21: 134 7- 135 5 Pawley JB: Handbook of Biological Confocal Microscopy New York, Plenum Press; 1995 Binnig G, Quate CF, Gerber Ch: Atomic force microscope Phys Rev Let 1986, 56: 930 - 933 Binnig ... Structure and Composition of the Fusion Pore Biophys J 20 03, 84(2): 133 7- 134 3 Weyn B, Kalle W, Kumar-Singh S, Van Marck E, Tanke H, Jacob W: Atomic force microscopy: influence of air drying and fixation...
- 10
- 263
- 0
báo cáo khoa học: " Molecular and functional analyses of COPT/Ctrtype copper transporter-like gene family in rice" pdf
Ngày tải lên :
11/08/2014, 11:22
... GQ387494), COPT2 (Os01g56 430 ; HQ 833 6 53) , COPT3 (Os03g25470; HQ 833 654), COPT4 (Os04g 339 00; HQ 833 655), COPT5 (Os05g35050; GQ387495), COPT6 (Os08g35490; HQ 833 656), and COPT7 (Os09g26900; HQ 833 657), ... into the BamHI/EcoRI sites of p413GPD(+His) vector and the cDNAs of COPT4 and COPT7 were subcloned into the SpeI/EcoRI sites of p413GPD(+His) separately [39 ] The cDNA of S cerevisiae Ctr1 was amplified ... coexpression of COPT6 facilitated expression of COPT2, COPT3, or COPT4 in the plasma membrane of yeast cells (Figure 6), we coexpressed each two of the four proteins in fet3fet4DEY14 53 and zrt1zrt2ZHY3...
- 12
- 334
- 0
Báo cáo y học: "Extra-cellular release and blood diffusion of BART viral micro-RNAs produced by EBV-infected nasopharyngeal carcinoma cells" pps
Ngày tải lên :
12/08/2014, 01:22
... Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas J Virol 2009, 83: 333 3 -33 41 17 Pratt ZL, Kuzembayeva M, Sengupta S, Sugden B: The microRNAs of Epstein-Barr ... < 200 3, 47 HEP 10 63- M-France Larynx squamous cell carcinoma T4N2M0 NA Anti-EBNA:7, 13 Anti-VCA: 3, 73 < 200 57,5 TBS 53- M-Algeria NA NA NA Anti-EBNA: 2,79 Anti-VCA: 2,46 < 200 37 ,7 TBS 34 -F-France ... delivery of viral miRNAs via exosomes Proc Natl Acad Sci USA 2010, 107: 632 8- 633 3 Kosaka N, Iguchi H, Yoshioka Y, Takeshita F, Matsuki Y, Ochiya T: Secretory mechanisms and intercellular transfer of...
- 12
- 341
- 0
Báo cáo y học: "Molecular and immunological characterization of allergens from the entomopathogenic fungus Beauveria bassiana" ppsx
Ngày tải lên :
13/08/2014, 13:22
... study of seasonal fungus prevalence inside and 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 outside dwellings of asthmatic patients living in northeast Netherlands Ann Allergy 1984, 53: 486-492 ... extracts of soluble fractions lanes 1), 3) , 5) and 7), and pellet fractions, lanes 2), 4), 6), and 8) Expression of Bb-Eno1, lanes 1) and 2), Bb-f2, lanes 3) and 4), Bb-Ald, lanes 5) and 6), and Bb-Hex, ... DQ767719 U82 437 X78226 AF284645 XM3 231 50 AF2546 43 DQ767720 AAC6 935 7 XP659 435 AAC00525 AAC49898 DQ767721 X78227 X78228 AF27 534 7 XM951769 XM6 530 66 DQ767722 DQ00 031 9 XM742214 AB085840 AAB34785 E-value...
- 11
- 278
- 0
MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS
Ngày tải lên :
09/09/2015, 08:13
... Figure 3. 1: Sections of A officinalis young and mature leaves 65 Figure 3. 2: Adaxial and abaxial surfaces of A officinalis fresh and dried leaves 66 Figure 3. 3: Determination of salt gland ... A officinalis leaves 67 Figure 3. 4: Salt gland structure from A officinalis leaves 69 Figure 3. 5: Estimation of ions in xylem sap of A officinalis 71 Figure 3. 6: Estimation of ... profile of AoPIP1.2 1 63 Figure 6.12: cDNA and genomic DNA sequences of AoPIP2.2 165 Figure 6. 13: Phylogenetic analysis and sequence alignment of AoPIP2.2 166 Figure 6.14: Sub-cellular...
- 218
- 765
- 0
Molecular and morphological characterization of caudal neural tube defects in embryos of diabetic swiss albino mice
Ngày tải lên :
11/09/2015, 09:04
... Preparation of cRNA probes 53 2.10 .3 Preparation of competent cells 53 2.10 .3. 1 Materials 53 2.10 .3. 2 Procedure 54 2.10.4 Transformation of competent ... combinatorial actions of three HD proteins, Dbx, Pax6 and Irx3 mediate the position of the three most ventral neuronal subtypes while Olig2 and Nkx2.2 control the position of motoneurons and V3 neurons respectively ... 1.2.4.2.2.2 Islet 23 1.2.4.2 .3 Other molecular factors .25 1.2.4.2 .3. 1 Brain lipid-binding protein 25 1.2.4.2 .3. 2 Doublecortin .26 1 .3 Development of dorsal root ganglia...
- 178
- 297
- 0
MOLECULAR AND FUNCTIONAL CHARACTERISATION OF THE ROLE OF HYDROGEN SULPHIDE IN SEXUAL MEDICINE
Ngày tải lên :
12/10/2015, 17:33
... 31 3. 2.2.1 Measurement of cGMP and cAMP concentration 32 3. 2 .3 Experimental protocol to investigate effects of H2S on erectile function in vivo 33 3. 2 .3. 1 Measurement of intracavernosal ... 33 Figure 3. 2 Schematic representation of experimental protocol for in vivo study 34 Figure 3. 3a Animal preparation and the pelvic plexus 36 Figure 3. 3b Perineal anatomy of the rat ... 37 3. 2.4.2 Measurement of plasma H2S concentration 38 3. 2.4 .3 Measurement of NO concentration in plasma and corpus cavernosum 38 3. 2.5 Experimental protocol to investigate effects of...
- 151
- 758
- 0