cd27 memory b cells in bm and is a hallmark of rituximab treatment
Báo cáo y học: "Expression of cartilage-derived morphogenetic protein in human intervertebral discs and its effect on matrix synthesis in degenerate human nucleus pulposus cells" potx
Ngày tải lên :
09/08/2014, 14:22
... microscope and images captured using a digital camera and Bioquant Nova image analysis system (BIOQUANT Image Analysis Corporation, Nashville TN, USA) Each section was divided into three areas for analysis: ... content per bead and means and standard errors calculated In addition DNA content per bead was calculated as an indication of cell proliferation Available online http://arthritis-research.com/content/11/5/R137 ... counterstained with Mayers Haematoxylin (Raymond A Lamb, Eastbourne, East Sussex, UK), dehydrated and mounted in XAM (BDH, Poole, UK) Image analysis All slides were visualised using Leica RMDB research...
- 10
- 437
- 0
Báo cáo khoa học: Ribonuclease H: properties, substrate specificity and roles in retroviral reverse transcription ppt
Ngày tải lên :
30/03/2014, 02:20
... cleavage modes for retroviral RNases H DNA ⁄ RNA hybrids are drawn with RNA strands in red and DNA strands in black In the internal cleavage mode, the arrows mark the sites of cleavage along ... Fay PJ & Bambara RA (1994) Quantitative analysis of RNA cleavage during RNA-directed DNA synthesis by human immunodeficiency and avian myeloblastosis virus reverse transcriptases Nucleic Acids Res ... mutagenesis of individual amino acids Notable examples include changes at Trp266 and Phe61 in HIV-1 reverse transcriptase, both of which render the RNase H incapable of generating the polypurine tract...
- 11
- 296
- 0
Báo cáo sinh học: " Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" pdf
Ngày tải lên :
19/06/2014, 08:20
... place of dTTP and in the case of some manufacturers to include UNG as a standard reagent in kits The success of this approach for elimination of contaminating amplicon DNA depends on the availability ... contaminating uracil-containing DNA while leaving the natural, thymine-containing DNA intact The precise, reproducible quantification of realtime RT-PCR provides a rapid method to assess and ... 20, and 30 minutes were evaluated for DNA degradation and the effect on RNA amplification by RT-PCR (Table 4) An incubation of 10 eliminated DNA detection at the lowest concentration and increased...
- 8
- 678
- 0
báo cáo hóa học:" Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" ppt
Ngày tải lên :
20/06/2014, 04:20
... place of dTTP and in the case of some manufacturers to include UNG as a standard reagent in kits The success of this approach for elimination of contaminating amplicon DNA depends on the availability ... contaminating uracil-containing DNA while leaving the natural, thymine-containing DNA intact The precise, reproducible quantification of realtime RT-PCR provides a rapid method to assess and ... 20, and 30 minutes were evaluated for DNA degradation and the effect on RNA amplification by RT-PCR (Table 4) An incubation of 10 eliminated DNA detection at the lowest concentration and increased...
- 8
- 475
- 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
Ngày tải lên :
07/08/2014, 18:21
... '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 '3-CCATTGTRCGCTGTGAGC-'5 '3-CACGACCCCAACGTGTGT-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/4 2A 674152JA ... gnisu dengised erew stegrat lla rof seborp dna sremirp RCP-TR* emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5...
- 6
- 347
- 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
Ngày tải lên :
11/08/2014, 08:20
... 400 µl of whole blood, comparable amounts to that obtained from infants via heelstick This mRNA was used to quantify the amount of CD4, CD8, as well as GAPDH, mRNA that is being transcribed in T ... constructed by Lipman et al., (1994), and were kindly provided by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' ... competitor cDNA was amplified in the same reaction tube as unknown amounts of sample derived RT-cDNA This cDNA was obtained as follows Total RNA is extracted from 400 µl to ml of Page of (page number not...
- 4
- 319
- 0
Báo cáo y học: " Variability in a dominant block to SIV early reverse transcription in rhesus monkey cells predicts in vivo viral replication and time to death" pot
Ngày tải lên :
12/08/2014, 04:20
... phenotyping and staging assay TS participated in B- LCL phenotyping, staging, and fusion assay TC participated in staging and fusion assay AH participated in in vivo correlation studies All authors have ... is capable of inhibiting early RT, can impact the in vivo clinical outcome of the animals infected with SIV A complete understanding of the host immune mechanisms that have a significant impact ... (Fig 1B) To assess the nature of this variable susceptibility phenotype in these PBMC, we examined the kinetics of viral replication in each PBMC population by sequential analysis of p27 production...
- 11
- 340
- 0
Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx
Ngày tải lên :
12/08/2014, 04:20
... viruses, and showed presence of vaccine strain Three independent inter- and intra-assay replicates of the multiplex RT-nPCR gave consistent results, indicating the repeatability of the assay Figure Amplification ... control of CDV In addition to traditional methods using virus isolation, several promising antigenELISA, AGP, and FA methods have been developed and evaluated However, these methods are laborious and ... Academy of Agricultural Sciences, Harbin, China and 2Qingdao Agricultural University, Qingdao 266109, China Received: 28 January 2010 Accepted: May 2010 Published: May 2010 © 2010 Si et al; Access7:86...
- 6
- 480
- 0
Báo cáo y học: " The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro" doc
Ngày tải lên :
12/08/2014, 23:23
... Purification and biophysical characterization of GSTand NusA-HuR (A) Analysis of the expression and purification of GSTHuR by SDS PAGE Lanes and illustrate total protein and total soluble protein after ... Light-scattering data were obtained using an analytical Superdex-200 column (1 cm × 30 cm) with in- line multiangle light-scattering (DAWN HELEOS, Wyatt Technology, Inc., Santa Barbara, CA) and refractive ... Opaluch AM, Caldwell JS, Weitzman MD, Kuhen KL, Bandyopadhyay S, Ideker T, Orth AP, Miraglia LJ, Bushman FD, Young JA, Chanda SK: Global analysis of host-pathogen interactions that regulate early-stage...
- 7
- 258
- 0
Báo cáo y học: "Early and transient reverse transcription during primary deltaretroviral infection of sheep" ppt
Ngày tải lên :
13/08/2014, 06:20
... end labeled with LC Red640 Standardization of the amount of DNA subjected to quantification was performed with quantitation of the sheep betaglobin gene as an internal standard [40] The standard ... increased earlier than that of abundant clones, with, for each animal, a 3-day interval between the first peaks Figures 1B and show that during primary infection a burst of clonal expansion characterized ... beta-globin was generated using DNA extracted from BLV negative sheep blood cells Detection and quantification of the clonal distribution of circulating BLV positive cells in vivo BLV integration...
- 12
- 217
- 0
Báo cáo y học: " Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import" pps
Ngày tải lên :
13/08/2014, 09:21
... IN5 0-288 cDNA are IN5 0-HindIIIATG-5'(5'– GCGCAAGCTTGGATAGATGCATGGACAAGTAG-3) and 3' -IN- Asp718 and primers for amplifying IN1 -212 cDNA are IN- HindIII-ATG-5' and IN- 212-XmaI3'(5'-CAATTCCCGGGTTTGTATGTCTGTTTGC-3) ... domain and a Cterminal domain, all of which are required for a complete integration reaction The N-terminal domain harbors an HHCC-type zinc binding domain and is implicated in the multimerization ... contributes to IN nuclear localization, we replaced an arginine and a lysine at positions of 263 and 264 by alanines in this region and generated a mutant (INRK263,4AA-YFP) The protein expression of...
- 15
- 416
- 0
Harvesting, oil extraction, and conversion of local filamentous algae growing in wastewater into biodiesel
Ngày tải lên :
05/09/2013, 15:28
... extraction method for obtaining oil from algal cells and analyzing its quality, (iii) increasing the quantity of algal oil to generate a reasonable amount of biodiesel fuel, and (iv) conversion of ... treatment plant and was identified as a source for abundant filamentous algae The algae grow submerged in multiple drainage channels (launders) leading away from effluent final settling tanks; water ... glycerol backbone remains Depending on the number of hydrocarbon tails attached to the glycerol group, between one and three FAMEs can be obtained These FAMEs may have hydrocarbon chains of the same...
- 6
- 488
- 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
Ngày tải lên :
10/02/2014, 20:39
... Ames, IA: Blackwell Publishing Professional 46 Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken C, Kawaoka Y (2009), “Phylogenetic characterization of H5N1 avian influenza ... Uiprasertkul, M., R Kitphati, P Puthavathana, R Kriwong, A Kongchanagul, K Ungchusak, S Angkasekwinai, K Chokephaibulkit, K Srisook, N Vanprapar, and P Auewarakul (2007), “Apoptosis and pathogenesis ... surgical masks and respirators in health care settings during an influenza pandemic 13 Chan PK (2002), “Outbreak of avian influenza A (H5N1) virus infection in Hong Kong in 1997”, Clin Infect Dis,...
- 11
- 581
- 0
Tài liệu Báo cáo khoa học: Efficient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt
Ngày tải lên :
20/02/2014, 01:20
... application of twin ribozymes may lead to a number of interesting strategies in molecular biology, genome analysis and possibly molecular medicine It is certainly advantageous having a number of ... consists of two domains joined by a single-stranded linker of eight adenosine residues and binds the 3¢-terminal part of its substrate via a duplex of bp (Fig 2A) The second part of the twin ribozyme ... clipping of a fragment of desired length and sequence from a natural RNA may be a useful application For example, RNA fragments that involve modified nucleobases are easily obtainable from naturally...
- 11
- 481
- 0
Tài liệu Báo cáo khoa học: "Extraction and Approximation of Numerical Attributes from the Web" pdf
Ngày tải lên :
20/02/2014, 04:20
... set of lexical patterns in order to extract attribute values of these objects and available comparison/boundary information Finally, we analyze the obtained information and select or approximate ... Utilization of information about comparable objects provided a significant boost to numerical attribute extraction quality, and allowed a meaningful approximation of missing attribute values Section ... Relationships Using Pattern Clusters and its Evaluation by Automatically Generated SAT Analogy Questions ACL ’08 Roxana Girju, Adriana Badulescu, and Dan Moldovan 2006 Automatic discovery of part-whole...
- 10
- 465
- 0
Tài liệu Báo cáo khoa học: "A Mobile Touchable Application for Online Topic Graph Extraction and Exploration of Web Content" ppt
Ngày tải lên :
20/02/2014, 05:20
... like EEUU and NLF, questions about persons like Justin Bieber, David Beckham, Pete Best, Clark Kent, and Wendy Carlos , and general themes like Brisbane, Balancity, and Adidas The task was not only ... Linguistics An International o Handbook, Mouton de Gruyter, Berlin Christian Bizer, Jens Lehmann, Georgi Kobilarov, Soren Auer, Christian Becker, Richard Cyganiak, Sebastian Hellmann 2009 DBpedia ... “Justin Bieber” The user can double touch on a node to display the associated snippets and web pages Since a topic graph can be very large, not all nodes are displayed Nodes, which can be expanded...
- 6
- 458
- 0
Tài liệu Báo cáo khoa học: "Integrating Information Extraction and Automatic Hyperlinking" docx
Ngày tải lên :
20/02/2014, 16:20
... (Przepiórkowski and Wolinski, 2003) for Polish For Asian languages, we integrated Chasen (Asahara and Matsumoto, 2000) for Japanese and Shanxi (Liu, 2000) for Chinese The XTDL-based grammar engineering platform ... has been used to define grammars for English, German, French, Spanish, Chinese and Japanese allowing for named entity recognition and extraction To guarantee a comparable coverage, and to ease ... edge in such an automaton must be analyzed, since TFS annotations can be arranged under subsumption, and the failure of a general edge automatically causes the failure of several, more specialized...
- 4
- 356
- 0
Tài liệu Báo cáo khoa học: "A HARDWARE ALGORITHM FOR HIGH SPEED MORPHEME EXTRACTION AND ITS IMPLEMENTATION" pptx
Ngày tải lên :
21/02/2014, 20:20
... which have no explicit word boundaries, than for Engllsh and many European languages (Miyazald, 1983) (Ohyama, 1986) (Abe, 1986) English text reading has the advantage of including blanks between ... text parsing systems This process is necessary for natural language parsing, because it is the first step in the parsing However, it is more laborious for Japanese and several other languages, ... signal is output In this comparison, the remainder symbol operates as a wild card This means that the comparator also outputs a match signal when the ~-th character memory < /b> outputs the remainder...
- 8
- 504
- 0
Building bone vitality: A Revolutionary Diet Plan to Prevent Bone Loss and Reverse Osteoporosis pdf
Ngày tải lên :
05/03/2014, 20:20
... that allows bone to absorb and retain—dietary calcium You’ll find that low-acid eating is quite simple Eat two servings of fruit and/ or vegetables at every meal and snack on fruit and vegetables And ... statisticians In the 1970s they came up with meta-analysis, a mathematical way to combine small clinical trials as though they’d all been part of one big one A meta-analysis can make ten trials of a hundred ... study Israel lies much closer to the equator than Scandinavia Yet American- or European-born Israelis suffer hip fractures at rates almost as high as those in Sweden and Finland Consider Washington,...
- 257
- 268
- 1
Glycemic Load Diet Cookbook: 150 RECIPES TO HELP YOU LOSE WEIGHT AND REVERSE INSULIN RESISTANCE docx
Ngày tải lên :
06/03/2014, 05:20
... grams of available carbohydrate in a typical serving: let’s use white bread and whole wheat bread as examples White bread has a glycemic index of 100, and whole wheat bread has a glycemic index of ... size is small—about as much as you can wrap your fist around—it won’t raise your blood sugar as much as a slice of bread The point is that the amount of available carbohydrate in a serving of food ... food, oranges have a glycemic index of 60, which means fifty grams of available carbohydrate in an orange will raise blood sugar 60 percent as much as fi fty grams of available carbohydrate in white...
- 286
- 421
- 0