0

ccs c for pic16f877a

CCS C for PIC16F877A potx

CCS C for PIC16F877A potx

Quản trị Web

... Keil C, HT-PIC, MikroC, CCS Tôi chọn CCS cho giới thiệu CCS c ng c lập trình C mạnh cho Vi điều khiển PIC Những ưu như c điểm CCS đề c p đến phần 1.2 Giới thiệu CCS ? CCS trình biên dịch lập ... c u tr c sau viết CCS C viết lại dần lên, t c độ l c nhanh viết ASM nhiều Khi viết CCS C thông thường dịch file.hex c dài so với viết ASM Hai ngôn ngữ CCS C HT-PIC ưa chuộng c , CCS C dễ h c, gần ... http://www.picvietnam.com - 23 - CCS C for PIC16F877A 24/06/2008 đề c p đến app note 863 Microchip Bạn tìm đ c app note web site Microchip +cho em hoi ccs co ho tro vong lap " for" ko vay cac bac em...
  • 251
  • 771
  • 1
CCS-C-cho-PIC16F877A tham khao.pdf

CCS-C-cho-PIC16F877A tham khao.pdf

Điện - Điện tử

... Keil C, HT-PIC, MikroC, CCS Tôi chọn CCS cho giới thiệu CCS c ng c lập trình C mạnh cho Vi điều khiển PIC Những ưu như c điểm CCS đề c p đến phần 1.2 Giới thiệu CCS ? CCS trình biên dịch lập ... c u tr c sau viết CCS C viết lại dần lên, t c độ l c nhanh viết ASM nhiều Khi viết CCS C thông thường dịch file.hex c dài so với viết ASM Hai ngôn ngữ CCS C HT-PIC ưa chuộng c , CCS C dễ h c, gần ... xuống chân RA4 RTCC_DIV_2 :chia prescaler 1:2 RTCC_DIV_4 1:4 RTCC_DIV_8 1:8 RTCC_DIV_16 1:16 RTCC_DIV_32 1:32 RTCC_DIV_64 1:64 RTCC_DIV_128 1:128 RTCC_DIV_256 1:256 rtcc_state constant sau: RTCC_INTERNAL...
  • 250
  • 9,296
  • 237
CCS C cho PIC16F877A

CCS C cho PIC16F877A

Kỹ thuật lập trình

... Keil C, HT-PIC, MikroC, CCS Tôi chọn CCS cho giới thiệu CCS c ng c lập trình C mạnh cho Vi điều khiển PIC Những ưu như c điểm CCS đề c p đến phần 1.2 Giới thiệu CCS ? CCS trình biên dịch lập ... c u tr c sau viết CCS C viết lại dần lên, t c độ l c nhanh viết ASM nhiều Khi viết CCS C thông thường dịch file.hex c dài so với viết ASM Hai ngôn ngữ CCS C HT-PIC ưa chuộng c , CCS C dễ h c, gần ... xuống chân RA4 RTCC_DIV_2 :chia prescaler 1:2 RTCC_DIV_4 1:4 RTCC_DIV_8 1:8 RTCC_DIV_16 1:16 RTCC_DIV_32 1:32 RTCC_DIV_64 1:64 RTCC_DIV_128 1:128 RTCC_DIV_256 1:256 rtcc_state constant sau: RTCC_INTERNAL...
  • 250
  • 1,034
  • 26
CCS C cho PIC16F877A 2008

CCS C cho PIC16F877A 2008

Kỹ thuật lập trình

... Keil C, HT-PIC, MikroC, CCS Tôi chọn CCS cho giới thiệu CCS c ng c lập trình C mạnh cho Vi điều khiển PIC Những ưu như c điểm CCS đề c p đến phần 1.2 Giới thiệu CCS ? CCS trình biên dịch lập ... c u tr c sau viết CCS C viết lại dần lên, t c độ l c nhanh viết ASM nhiều Khi viết CCS C thông thường dịch file.hex c dài so với viết ASM Hai ngôn ngữ CCS C HT-PIC ưa chuộng c , CCS C dễ h c, gần ... xuống chân RA4 RTCC_DIV_2 :chia prescaler 1:2 RTCC_DIV_4 1:4 RTCC_DIV_8 1:8 RTCC_DIV_16 1:16 RTCC_DIV_32 1:32 RTCC_DIV_64 1:64 RTCC_DIV_128 1:128 RTCC_DIV_256 1:256 rtcc_state constant sau: RTCC_INTERNAL...
  • 250
  • 672
  • 12
CCS c cho PIC16F877A 2008

CCS c cho PIC16F877A 2008

Điện - Điện tử

... Keil C, HT-PIC, MikroC, CCS Tôi chọn CCS cho giới thiệu CCS c ng c lập trình C mạnh cho Vi điều khiển PIC Những ưu như c điểm CCS đề c p đến phần 1.2 Giới thiệu CCS ? CCS trình biên dịch lập ... c u tr c sau viết CCS C viết lại dần lên, t c độ l c nhanh viết ASM nhiều Khi viết CCS C thông thường dịch file.hex c dài so với viết ASM Hai ngôn ngữ CCS C HT-PIC ưa chuộng c , CCS C dễ h c, gần ... http://www.picvietnam.com - 23 - CCS C for PIC16F877A 24/06/2008 đề c p đến app note 863 Microchip Bạn tìm đ c app note web site Microchip +cho em hoi ccs co ho tro vong lap " for" ko vay cac bac em...
  • 250
  • 583
  • 9
Giáo trình lập trình C for Winform

Giáo trình lập trình C for Winform

Kỹ thuật lập trình

... hdc = BeginPaint(hWnd, &ps); // Lấy kích thư c vùng client c a sổ hành RECT rect; GetClientRect(hWnd, &rect); // Tạo MDC tương thích với DC c a sổ HDC hMemDC; hMemDC = CreateCompatibleDC(hdc); ... Minh Thái wcex.lpfnWndProc = (WNDPROC)WndProc; wcex.cbClsExtra = 0; wcex.cbWndExtra = 0; wcex.hInstance = hInstance; wcex.hIcon = LoadIcon(hInstance, (LPCTSTR)IDI_BT1); wcex.hCursor = LoadCursor(NULL, ... HDC hdc ; RECT rect ; hdc = GetDC (hwnd) ; GetClientRect (hwnd, &rect) ; if(iBrush==IDC_HS_BDIAGONAL) hbrush=CreateHatchBrush(HS_BDIAGONAL, crColor[iColor-IDC_BLACK]); if(iBrush == IDC_HS_CROSS)...
  • 69
  • 499
  • 5
Tài liệu C for The Microprocessor Engineer P2 doc

Tài liệu C for The Microprocessor Engineer P2 doc

Phần cứng

... Index and Stack Pointer registers as well as 8- and 16-bit Accumulators Table 2.6 Operations which affect the Program Counter Operation Mnemonic Description Bcc LBcc cc is the logical condition ... Logic instructions Flags Mnemonic V N Z C ASL ANDCC #nn Description Logic bitwise AND √ √ • [A]
  • 20
  • 607
  • 0
Tài liệu C for The Microprocessor Engineer P1 docx

Tài liệu C for The Microprocessor Engineer P1 docx

Phần cứng

... secondary decoder for simple interface circuitry 18 C FOR THE MICROPROCESSOR ENGINEER References [1] Noyce, R.N and Marcian, E H.; A History of Microprocessor Development at Intel, IEEE Micro, ... instruction execution This gives a response delay (sometimes called a latency) of cycles, as opposed to a worst-case Halt latency of 21 cycles [5] The payback is that because the C FOR THE MICROPROCESSOR ... structure of an asynchronous common-bus micro-computer 72 The 68000/8 Read cycle 73 The 68000/8 Write cycle 75 A simple address decoder with no-wait feedback circuitry 77 A DTACK generator for...
  • 30
  • 404
  • 0
Tài liệu Lập trình C for Windows ppt

Tài liệu Lập trình C for Windows ppt

Kỹ thuật lập trình

... hdc = BeginPaint(hWnd, &ps); // Lấy kích thư c vùng client c a sổ hành RECT rect; GetClientRect(hWnd, &rect); // Tạo MDC tương thích với DC c a sổ HDC hMemDC; hMemDC = CreateCompatibleDC(hdc); ... Minh Thái wcex.lpfnWndProc = (WNDPROC)WndProc; wcex.cbClsExtra = 0; wcex.cbWndExtra = 0; wcex.hInstance = hInstance; wcex.hIcon = LoadIcon(hInstance, (LPCTSTR)IDI_BT1); wcex.hCursor = LoadCursor(NULL, ... HDC hdc ; RECT rect ; hdc = GetDC (hwnd) ; GetClientRect (hwnd, &rect) ; if(iBrush==IDC_HS_BDIAGONAL) hbrush=CreateHatchBrush(HS_BDIAGONAL, crColor[iColor-IDC_BLACK]); if(iBrush == IDC_HS_CROSS)...
  • 70
  • 404
  • 0
ứng dụng lập trình ccs c cho pic 16f877a

ứng dụng lập trình ccs c cho pic 16f877a

Điện - Điện tử

... Assembly - CCS chứa nhiều h m ph c vụ cho m c đích v c nhiều c ch lập trình m cho vấn đề với t c độ th c thi v độ d i chơng trình kh c Sự tối u l kĩ lập trình ngời - CCS cung c p c ng c tiện ích giám ... động hay vô hiệu hoá tính CCP X: tên chân CCP chip (với PIC 16F877A l chân RC1-CCP2 ; RC2-CCP1) Mode: CCP_PWM (bật chế độ PWM) - SET_CCPx_DUTY(value) X: tên chân CCP chip Value: giá trị hay 16 ... EEPROM) III )C C CHÂN C A PIC 16F877A 1 )c c chân nguồn Trong sơ đồ mạch 8051 thờng kí hiệu chân c p nguồn l VCC , chân nối mass l GND C n PIC ng c lại thay VCC = VDD chân GND = VSS Trong PIC 16F877A...
  • 37
  • 1,609
  • 4
Tài liệu Symbian OS C++ for Mobile Phones doc

Tài liệu Symbian OS C++ for Mobile Phones doc

Kỹ thuật lập trình

... objects The basic unit of execution – a sequence of instructions that can be executed A mechanism that separates the safe constructions (which can be put into the constructor) from the unsafe constructions ... MainL(): a cleanup stack and a console Our code for E32Main() is: // Cleanup stack harness GLDEF _C TInt E32Main() { UHEAP_MARK; CTrapCleanup* cleanupStack = CTrapCleanup::New(); TRAPD(error, ConsoleMainL()); ... C+ + source code: // hellotext.cpp #include #include LOCAL_D CConsoleBase* gConsole; // Real main function void MainL() { gConsole->Printf(_L("Hello world!\n")); } // Console...
  • 836
  • 287
  • 0
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

Báo cáo khoa học

... aspartic protease inhibitor, pepstatin, did not influence the activity Inorganic compounds such as LiCl, H2BO3, NaCl, MgSO4, MgCl2, AlCl3, KCl, CaCl2, CrCl3, MnSO4, MnCl2, FeSO4, FeCl3, CoCl2, NiCl2, ... AtagACCATGCGTATCCGTGAGCTTGGCATCACC-3¢; antisense primer, 5¢-ACGCAATCTAGAGTCAGCCCTCA GGGGGCTTTCG-3¢ The amplified PCR product was digested with HindIII and XbaI (Takara Bio Inc.), separated by agarose-gel electrophoresis ... vancomycin-resistant enterococci, VanX from the glycopeptide antibiotic producer Streptomyces toyocaensis and DdpX from Escherichia coli are considered to be involved in vancomycin-resistance,...
  • 10
  • 406
  • 0
c for pic pptx

c for pic pptx

Tài liệu khác

... để giải vấn đề c ch dễ dàng c ch viết bốn ch c th c theo chu kỳ và Cuốn sách mô tả ứng dụng c thể ngôn ngữ lập trình C, ngôn ngữ t c C sử dụng cho mikroC PRO cho PICtrình biên dịch Trong trường ... h c 'nhào lộn' th c Người dùng xem kết cuối Cuối c ng, khó để giải thích sân bay bạn sử dụng từ thích hợp chẳng hạn trái, phải, km CISC (Complex Instruction SET COMPUTER) CISC đối diện với RISC! ... c ch tương tự logic hoạt động KHÔNG GATE C c cổng logic đầu vào c đầu Nó hoạt động c ch đơn giản Khi logic không (0) xuất đầu vào nó, logic (1) xuất đầu ngư c lại Nó c nghĩa c a đảo ngư c tín...
  • 343
  • 447
  • 0
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx

Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx

Báo cáo khoa học

... Library construction 7210 (‹) (fi) (fi) (fi) (‹) (‹) (‹) 7211 (‹) GTCTCGCGGCCCAGCCGGCCATGGCCGCAAGGGTGGACCAAACACC GTCTCGCGGCCCAGCCGGCCATGGCCGCATGGGTAGACCAAACACC CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC CACGTTATCTGCGGCCGCTTTCACGGTTAATACGGTGCCAGCTCC ... CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC CACGTTATCTGCGGCCGCTTTCACGGTTAATACGGTGCCAGCTCC GGTTAATACGGTGCCAGCTCCCYYMNNMNNMNNMNNMNNRYHRYH RYHRYHMNNMNNMNNMNNMNNMNNTGCTCCACACTTATACGTGCCACTG TTTCACGGTTAATACGGTGCCAGCTCCTTTCTCMNNMNNMNNMNNRYHR ... PCR using oligonucleotide primers N8517 (Forward: 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC...
  • 12
  • 522
  • 0
Cay horstmannn   c++ for everyone

Cay horstmannn c++ for everyone

Kỹ thuật lập trình

... easily recognizable for (counter = 1; counter
  • 562
  • 508
  • 0
Dan gookin   c for dummies 2004

Dan gookin c for dummies 2004

Kỹ thuật lập trình

... Each little oddball character and nutty parenthesis is important to the C language! ߜ Here’s a hint on the common GCC command to compile this source code: gcc error .c -o error That’s the last compiling ... 131 Chapter 11: C More Math and the Sacred Order of Precedence 133 Chapter 12: C the Mighty if Command .147 Chapter 13: What If C= =C? .165 Chapter 14: Iffy C Logic ... bellows “Uncle! UNCLE! ” Get ready to take charge Chapter Up from the Primordial C In This Chapter ᮣ Hysterical C history ᮣ How C programs are created ᮣ Building the source code ᮣ Compiling and...
  • 411
  • 849
  • 0
Edward scheinerman   c++ for mathematicians

Edward scheinerman c++ for mathematicians

Kỹ thuật lập trình

... photocopy or use material electronically from this work, please access www.copyright.com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc (CCC) 222 Rosewood Drive, Danvers, ... is produced bad.cc: In function ‘int main()’: bad.cc:4: error: ‘cout’ undeclared (first use this function) bad.cc:4: error: (Each undeclared identifier is reported only once for each function it ... C. 5.7 Friends C. 5.8 Class templates C. 5.9 Inheritance Standard functions C. 6.1 Mathematical functions C. 6.2 Mathematical constants C. 6.3 Character...
  • 521
  • 143
  • 0
 c++ for engineers and scientists

c++ for engineers and scientists

Kỹ thuật lập trình

... more complicated example of performing a unit analysis for selecting correct conversion factors, consider converting days to seconds You can determine the correct form of each conversion factor ... and scientific fields, such as electrical, chemical, mechanical, and aeronautical engineering Preface 17 Appendixes This book includes four appendixes on operator precedence, ASCII character codes, ... 10 Introduction to Classes 553 10.1 Abstract Data Types in C+ + (Classes) Abstract Data Types Class Construction Terminology 553 555 556 563 Contents 10.2 Constructors Calling Constructors Overloaded...
  • 849
  • 876
  • 3
Introduction to c++ for financial engineers   an object oriented approach

Introduction to c++ for financial engineers an object oriented approach

Kỹ thuật lập trình

... Mechanics of C+ +: from Source Code to a Running Program 25 cout > d2; char c; // Character type cout > c; ... Numeric& y); template Numeric Min(const Numeric& x, const Numeric& y); // Max and Min of three numbers template Numeric Max(const Numeric& x,const Numeric& y,const ... errors in category E3 can be accommodated by using the exception mechanism in C+ + We discuss this topic in a later chapter 2.7 THE STRUCT CONCEPT This is a book on C+ + for Quantitative Finance and...
  • 441
  • 1,229
  • 0

Xem thêm