cardiac action potentials see table 1 3

Báo cáo y học: "Boundary effects influence velocity of transverse propagation of simulated cardiac action potentials" potx

Ngày tải lên : 13/08/2014, 23:20

... Only Entire C Chain Cell C1 Only Entire A Chain Cell A1 Only Entire B Chain Cell B1 Only 7 (A failed) 5 5 3 3 2 2 TPT ms 1. 2 1. 5 1. 2 1. 5 1. 6 1. 7 1. 7 1. 8 1. 0 1. 1 1. 2 1. 2 0.7 0.8 0.9 0.9 Transv ... Area Y/A 7×7 5×5 3 4 2 3 A B C D Ratio of relative edge area to interior area 28/49 = 0.57 20/25 = 0.80 14 /12 = 1. 17 10 /6 = 1. 67 4.7 3. 4 2.5 1. 9 -1. 38 1. 88 2.47 -1. 40 2.05 2. 93 Orthodromic direction; ... Electrocardiol 20 03, 36 (4):279-2 93 Sperelakis N: Propagation of action potentials between parallel chains of cardiac muscle cells in PSpice simulation Can J Physiol Pharmacol 20 03, 81: 1 -11 2 Sperelakis...

9
103
0

Báo cáo y học: " Propagated repolarization of simulated action potentials in cardiac muscle and smooth muscle" pptx

Ngày tải lên : 13/08/2014, 22:22

... (cm/s) CM SM θr 10 10 0 10 00 10 ,000 ∞ 10 ,000 1, 000 10 0 10 # # 95.4 15 .8 5.4 5.6 θr θa ## ## ## 50 86 200 # # 7 .1 30 75 750 θa 32 38 55 11 5 550 30 00 ## ## ## 73 11 4 400 3. 7 6.8 13 42 820 36 00 * Pulse ... 2005, 2:5 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 http://www.tbiomed.com/content/2 /1/ 5 Diaz PJ, Rudy Y, Plonsey R: Intercalated discs as a cause for discontinuous propagation in cardiac muscle ... between 10 ,000 MΩ (1 tunnel), 10 00 MΩ (10 tunnels in parallel), 10 0 MΩ (10 0 tunnels), 10 MΩ (1, 000 tunnels), and 1. 0 MΩ (10 ,000 tunnels) Each tunnel was assumed to have a conductance of 10 0 pS...

9
268
0

Báo cáo Y học: Isolation, enzymatic properties, and mode of action of an exo-1,3-b-glucanase from Trichoderma viride doc

Ngày tải lên : 24/03/2014, 04:21

... exo -1, 3- b-glucanase Substrate (Gn) Km (mM ) 10 3: Vmax (mmol:min 21: mg 21) 10 3: (Vmax/Km) (min 21 : mg 21) ln (Vmax/Km) G3G G3G3G G3G3G3G G3G3G3G3G G3G3G3G3G3G 16 .5 5.0 1. 9 2.0 2 .1 0 .36 5.5 14 16 18 ... oligosaccharide deﬁnitions, see footnotes): G4G4G3G and G4G3G were produced by digestion of barley glucan with a 1, 3 -1, 4-bglucanase and puriﬁed [26] The G3G3G3G3G3G, G3G3G3G3G, and G3G3G3G were prepared ... cichorioides Curdlan G4G3G G4G4G3G G6G 0 .12 mg:mL 21 0 .14 mg:mL 21 12 mg:mL 21 6.06 0.9 2.5 17 38 8 .3 0.0 21 0.0 034 0 .18 5 612 8 A A Kulminskaya et al (Eur J Biochem 268) q FEBS 20 01 Table Kinetic parameters...

9
554
0

Báo cáo sinh học : "Why do taste cells generate action potentials" potx

Ngày tải lên : 06/08/2014, 19:20

... DC000766 and P30 DC04657 References Roper S: Regenerative impulses in taste cells Science 19 83, 220 : 13 11- 1 31 2 Journal of Biology 2009, 8:42 http://jbiol.com/content/8/4/42 Journal of Biology 2009, ... tongue: the response to mucosal NaCl and amiloride J Membr Biol 19 91, 12 4 :33 - 41 Volume 8, Article 42 Vandenbeuch and Kinnamon 42.5 11 Yoshida R, Shigemura N, Sanematsu K, Yasumatsu K, Ishizuka S, ... inhibition of K currents by saccharin J Gen Physiol 19 90, 96 :10 61- 1084 10 Avenet P, Lindemann B: Noninvasive recording of receptor cell action potentials and sustained currents from single taste...

5
237
0

Essential Cardiac Electrophysiology Self Assessment - Part 1 pps

Ngày tải lên : 13/08/2014, 15:20

... Arrhythmia–therapy–Handbooks Electrophysiologic Techniques, Cardiac Handbooks WG 39 A 138 e 2007] QP 112 .5.E46A24 2007 612 .1 71 dc22 2006 015 740 ISBN - 13 : 978 -1- 40 51- 510 85 ISBN -10 : 1- 40 51- 510 80 A catalogue record for this title ... therapy of arrhythmias, 229 11 .1 11. 2 11 .3 11 .4 11 .5 11 .6 11 .7 Pharmacologic principles as applied to antiarrhythmic drugs, 230 Antiarrhythmic drugs, 234 Beta blockers, 239 Class III antiarrhythmic ... currents, 1. 1 1. 2 1. 3 Potassium channels and currents, Sodium channels and currents, 12 Calcium channels and currents, 16 Electrophysiologic effects of cardiac autonomic activity, 21 2 .1 2.2 2 .3 Adrenergic...

24
376
0

Báo cáo y học: "Donnan effect on chloride ion distribution as a determinant of body fluid composition that allows action potentials to spread via fast sodium channels" pot

Ngày tải lên : 13/08/2014, 16:20

... 10 00 -88.6 Red blood cell (based on 7) K+ 14 0 4.5 10 0 - 91. 8 Na+ 11 14 5 54 +68.9 Cl- 80 11 6 21 -9.9 -14 .3 Combined high permeability for potassium (field A3) and chloride (field A4) moves the resting ... normal hemoglobin (g/L) Dog 12 0 Viet.Potb.Pig 11 0 Rabbit Horse 10 0 Pig 90 Sheep Goat Cat 80 70 Llama Human r = 0.7624; p = 0.0064; y = 28.5026 + 7.7559*x 13 0 Cow 10 11 12 13 Low limit of normal albumin ... 219 - 219 238 2-2426 and 219 - 219 238 2- 238 6 from the Croatian Ministry of Science, Education and Sport Kurbel Theoretical Biology and Medical Modelling 2 011 , 8 :16 http://www.tbiomed.com/content/8 /1/ 16...

9
310
0

MVC Bài 03 action selector filter v1 1

Ngày tải lên : 11/10/2014, 14:25

... MyAction() [HttpPost] public ActionResult MyAction(MyModel model)  Đổi tên giao dịch Action [ActionName(“OtherName”)] public ActionResult MyAction()  Chỉ cho phép sử dụng @Html .Action( ) mã không cho ... Một Action sau định nghĩa triệu gọi theo POST GET public ActionResult MyAction()  Nếu muốn có gọi với POST hay GET đánh dấu Action với [HttpPost] hay [HttpGet] [HttpGet] public ActionResult MyAction() ... không cho phép gọi trực tiếp [ChildActionOnly] public ActionResult MyAction() Action filter sử dụng để thực nhiệm vụ xảy thời điểm thực khác action  Một số Action Filter cung cấp sẵn MVC4  [ValidateInput]...

15
999
1

the american practical navigator table 1 logarithms of numbers

Ngày tải lên : 09/05/2016, 08:52

... 565 73 566 91 56808 12 13 12 12 12 12 12 11 12 11 11 12 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 10 11 11 11 11 11 11 10 11 10 11 10 10 11 11 10 11 10 11 10 11 10 11 10 11 11 11 10 11 11 11 10 ... 14 14 14 13 13 13 14 13 13 13 14 13 13 14 13 13 13 13 13 13 13 12 12 13 12 12 12 14 15 15 14 15 14 14 14 14 14 14 13 14 13 14 14 14 13 14 14 13 13 13 13 13 13 13 13 13 13 12 12 13 13 13 13 13 ... 14 14 14 14 14 13 14 13 14 14 13 13 13 13 13 13 13 13 13 13 13 13 12 13 13 13 13 13 13 13 15 15 14 14 14 14 14 14 14 14 14 13 14 14 14 14 13 13 14 14 14 14 13 13 13 13 14 13 13 13 13 12 13 13 12 ...

10
218
0

An action research on the use of continuous feedback to improve the first year students' pronunciation at the english department, college of foreign languages, vietnam national university, hanoi part 1

Ngày tải lên : 07/11/2012, 14:58

... of time and money To what extend you agree with this statement? V Appendix 3: READING PASSAGES PASSAGE 1: JOB SATISFACTION Over the years, the development of different theories of management ... meaning, then pronounced it aloud Part 3: Attitude and problems with English pronunciation How important is pronunciation you think? a Not important b Important 10 What make pronunciation difficult ... Internet has some advantages and disadvantages Discuss with your partner about this IV Appendix 3: POSTTEST (MOCK SPEAKING TEST 2) Part one: Read aloud the following passage: Another feature of...

6
1.1K
2

Action plan for IELTS part 1

Ngày tải lên : 20/10/2013, 02:15

15
560
1

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Ngày tải lên : 06/03/2014, 09:22

... UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5 017 [5, 12 , 38 , 40] 536 2– 536 6 5428–5 437 5 418 –5 437 5558–5582 8047–8062 [48, 41, 15 , 17 , 8] A3 A5 A7 ISS ESE3 The HIV -1 encoded proteins Tat, which acts as ... proteins SC35, SRp40, and heterogeneous nuclear ribonucleoprotein A1 at the HIV -1 Tat exon splicing site J Biol Chem 2 81, 3 715 9 3 717 4 37 Karn J (19 99) Tackling Tat J Mol Biol 2 93, 235 –254 38 Li CJ, ... of cellular premRNA Microbes Infect 7, 11 50 11 60 35 Zhang X & Aida Y (2009) HIV -1 Vpr: a novel role in regulating RNA splicing Curr HIV Res 7, 16 3 16 8 36 Hallay H, Locker N, Ayadi L, Ropers D,...

10
434
0

Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt

Ngày tải lên : 07/03/2014, 09:20

... Y (2006) Niﬂumic acid suppresses 31 9 6 46 47 48 49 50 51 52 53 54 55 56 57 58 interleukin - 13 -induced asthma phenotypes Am J Respir Crit Care Med 17 3, 12 16 12 21 Munafo DB & Colombo MI (2002) Induction ... J Gene Med 2, 32 6 33 3 Rizo J & Sudhof TC (19 98) C2-domains, structure and function of a universal Ca2+-binding domain J Biol Chem 2 73, 15 879 15 882 FEBS Journal 274 (2007) 31 8 4– 31 9 7 ª 2007 The ... Crystal structure of the BCL–XL–beclin peptide complex: beclin is a 12 novel BH3-only protein J Biol Chem 282, 13 1 23 13 132 14 Pattingre S, Tassa A, Qu X, Garuti R, Liang XH, Mizushima N, Packer...

14
444
0

Cách Ghi 1 Action - Photoshop CS 2

Ngày tải lên : 13/03/2014, 14:51

... record ) : FOLDER : Baby – ACTION : Thuctap – Dưới tạo Actions phụ : a Menu Image > Adj > Levels Input Levels chọn : 10 -1. 3 418 9.Ok.Đã bổ sung Action Phụ Levels Tab Actions ( Hình ) b Filter > ... • Default Actions • Sample Actions • Mỗi Folder chứa Actions - Mỗi Action chứa action phụ - Mỗi action phụ chứa nhiều thao tác ( Hình ) Nhấp Menu xổ ... 10 ) Như bạn tạo Actions phụ : Levels – Gaussian Blur – Unsharp Mask – Hue/Saturation Nhấp Nút STOP RECORD đáy Tab Actions ( Hình 11 ) Như bạn tạo ACTION riêng bạn Bạn lấy Action nầy để áp...

6
290
0

Báo cáo khoa học: Peptides that bind the HIV-1 integrase and modulate its enzymatic activity – kinetic studies and mode of action pptx

Ngày tải lên : 22/03/2014, 16:21

... 15 416 8 15 817 2 16 217 6 16 618 0 17 018 4 17 418 8 18 219 6 18 6200 210 224 214 228 218 232 222 236 238 252 242256 246260 HIV IN residues 9 410 7 9 811 6 12 614 5 13 014 9 13 915 3 15 116 5 16 31 7 7 16 718 1 17 919 3 18 72 01 1 912 05 ... 18 72 01 1 912 05 19 5209 2 232 37 227242 2 31 2 46 235 250 240254 244257 252265 256269 30 432 2 30 832 6 31 6 33 5 32 033 8 34 035 5 34 436 0 34 836 4 PFV IN residues 2 2 4 3 DNA 4 3 2 10 Dim 10 15 12 5 5 3 Tet + + + + ... 56 63 5664 5667 5669 5670 56 71 5678 5679 5680 56 81 5682 56 83 5685 5686 5692 56 93 5694 5695 5699 5700 57 01 a Sequence NIH no 38 52 4256 6276 6680 7084 8296 9 410 8 9 811 2 11 012 4 11 8 13 2 12 2 13 6 12 614 0 15 416 8...

15
343
0

Ngừng tuần hoàn (Cardiac arrest) (Kỳ 1) docx

Ngày tải lên : 01/07/2014, 20:20

... tim-mạch, có tỷ lệ định không xác định nguyên nhân 1. 2 .1 Nguyên nhân nội khoa: Có nhiều nguyên nhân gây ngừng tuần hoàn, tóm tắt số nguyên nhân sau: 1. 2 .1. 1 Nguyên nhân bệnh tim-mạch: - Rung thất, nhịp ... phó giao cảm làm thủ thuật khác 1. 2 .1. 3 Dùng liều thuốc chữa loạn nhịp tim dùng không quy cách thuốc: quinidin, digitalis, dùng lợi tiểu mà không bồi phụ kali 1. 2 .1. 4 Do tai biến mạch máu não: ... ý thức sau 8 -10 giây sau ngừng tuần hoàn - Khi cung lượng máu lên não giảm khoảng 1/ 3 so với cung lượng máu lên não bình thường, tức khoảng 25 ml /10 0g chất xám (bình thường 75 ml /10 0g chất xám),...

7
318
2

Luận án kinh tế - "Human and action" - Chapter 1 pps

Ngày tải lên : 02/07/2014, 13:20

... Concerning Human Understanding, ed Fraser (Oxford, 18 94), I, 3 31 - 33 3; Leibniz, Nouveaux essais sur l’entendement humain, ed Fammarion, p 11 9 14 HUMAN ACTION He would not act; he would simply live ... goals of action and in a hypostasis of each Whereas praxeology says that the goal Cf Feuerbach, Sämmtliche Werke, ed Bolin and Jodl (Stuttgart, 19 07), X, 2 31 16 HUMAN ACTION of an action is ... Introduction to Social Psychology (14 th ed Boston, 19 21) , p 11 Cf Mises, Epistemological Problems of Economics, trans by G Reisman (New York, 19 60), pp 52 ff ACTING MAN 17 to kill He arranges his wishes...

19
423
0

LOẠN NHỊP TIM (CARDIAC ARRHYTHMIAS) - Phần 1 pdf

Ngày tải lên : 13/07/2014, 15:20

... tachycardia) > 10 0 đập/phút Rung nhĩ (atrial fibrillation) 80-220 đập /phút Futter nhĩ (atrial flutter) 10 0, 15 0, 30 0 đập/phút Tim nhịp nhanh thất 10 0 -12 0 đập/phút Tim nhịp nhanh thất 10 0 -16 0 đập/phút ... procainamide 17 mg/kg với tốc độ 20 mg/phút (phải ngừng lại hết loạn nhịp, hạ huyết áp, hay phức hợp QRS rộng 50% so với bề rộng nguyên thủy) Liều lượng Lidocaine đến 1, 5mg/kg, lập lại 15 phút tối đa 3mg/kg ... (tachyarrhythmia) với tần số 15 0 đập/phút nguyên nhân nguyên phát bất ổn huyết động Một tần số 15 0 đập/phút, đòi hỏi phải khử rung điện (electrical conversion), điều không thường xảy 3/ SỰ KHỬ RUNG ĐỒNG...

33
505
0

Giáo trình hướng dẫn cách tạo ra các action riêng biệt để làm flash trong Macromedia Flash phần 1 pps

Ngày tải lên : 23/07/2014, 09:20

... CHƯƠNG 11 CÁCH DÙNG BẢNG ACTIONS Bảng Actions cho phép bạn tạo hiệu chỉnh action cho đối tượng hay frame dùng hai chế độ hiệu chỉnh khác Bạn chọn action viết lại danh sách Toolbox, kéo thả action ... để kích hoạt bảng Actions Tiêu đề bảng Actions chuyển đổi thành Object Actions cho đối tượng chọn nút Movie Clip Frame Actions đối tượng chọn frame Chọn chế độ hiệu chỉnh cho action: TỦ SÁCH STK ... BẢNG ACTIONS TRONG CHẾ ĐỘ NORMAL MODE Trong chế độ Normal Mode, bạn tạo action cách chọn action danh sách bên trái bảng, gọi danh sách Toolbox Danh sách Toolbox gồm có thư mục Basic Actions, Actions,...

5
393
1