... other infected animals.
A change in the NA amino sequence may allow a
“back-door” to HA cleavage, leading to systemic
infection. This mutant NA will bind to plasminogen a
normal precursor in ...
plasminogen is converted to plasmin, the active form, it
functions asa protease to cleave HA which creates a
systemic infection as well [1]. Taubenberger [1]
reported
that this transformation ... have to
combat influenza is isolation and culling of infected fowls
as demonstrated by the government of China, Vietnam,
and Thailand. As human populations continue to increase
and interactions...
... 4179–
4 186 .
19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Acceler-
ated transport and maturation of lysosomal alpha-galac-
tosidase A in Fabry lymphoblasts by an enzyme
inhibitor. Nat Med ... 103, 1 381 3–1 381 8.
29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain
P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de-
oxynojirimycin asa pharmacological chaperone for
Gaucher disease. ... report:
improvement in cardiac function in the cardiac variant
of Fabry’s disease with galactose-infusion therapy. N
Engl J Med 345, 25–32.
18 Asano N, Ishii S, Kizu H, Ikeda K, Yasuda K, Kato A,
Martin...
...
ã That you want to help them
ã To see you as the solution to their
problem, and not be seen as your
problem
ã To be treated as mature adults,
not as children
ã That you will be patient ... belle loves and loses and loves again a slyly dashing
war profiteer as she struggles to protect her family and beloved plantation.
ã A pig raised by sheepdogs, learns to herd sheep with a little ... experiences and
rationalize
bad situations into good ones. You have a propensity towards narcotic addiction.
Twisted Apart, The Inside, And Then The Cookie:
You have a very curious nature. You take...
... L. lactis ald gene as follows.
A PCR fragment was generated using primer CP-pyk
(5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3Â)(Nẳ ... enzymes: J
l
a
las
ịẳ
0:0123 93:9 a
las
ị1 e
7: 1a
3:2
las
ị0:276, J
glucose
a
las
ịẳ
0:693 83 :3 a
las
ị1 e
6a
2:1
las
ị33:2 (User dened),
J
lactate
a
las
ịẳ0:919 129 a
las
ị1 e
6a
2:1
las
ị75:2 ... (5Â-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3Â) and pyk4
(5Â-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3Â) were
amplied. The PCR products were digested with XhoI ⁄
BamHI and BamHI ⁄ XbaI, respectively, and cloned...
... also
operate in the present case. The heat-induced activation
of kinases such as Akt has been shown to increase
HSF1 activity. Enhanced Ras maturation by heat stress
was associated with a heightened activation ... Suhan PJ (1 985 ) Morphological study of
the mammalian stress response: characterization of
changes in cytoplasmic organelles, cytoskeleton, and
nucleoli, and appearance of intranuclear actin filaments
in ... Sci USA 93, 387 0– 387 5.
12 Horvath I, Glatz A, Varvasovszki V, Torok Z, Pali T,
Balogh G, Kovacs E, Nadasdi L, Benko S, Joo F et al.
(19 98) Membrane physical state controls the signaling
mechanism...
... goals, a 6-stage procedure
for SRSD is adapted from the literature on
SRSD (e.g. Graham and Harris [19]; Mason,
Harris and Graham [ 18] ; Harris, Graham and
Mason [20]; Chalk, Hagan-Burke and ... two main
reasons. First, many autonomy experts
suggest it as an option to approach the
problem. According to Little [15], students
are not automatically autonomous in the
formal classroom. ...
believes that autonomy helps learning and that
learner training can contribute to promoting
learner autonomy. Information about learner
beliefs about language learning, learner
autonomy and self-regulation...
... 31547–31554.
52 Nara K, Ito S, Ito T, Suzuki Y, Ghoneim MA, Tachib-
ana S & Hirose S (1994) Elastase inhibitor elafin is a
new type of proteinase inhibitor which has a transglu-
taminase-mediated anchoring ... Malorni A
& Marino G (1 988 ) Substance P asa transglutaminase
substrate: identification of the reaction products by fast
atom bombardment mass spectrometry. Anal Biochem
172, 499–503.
15 Hohenadl ... Facchiano AM, Facchiano A & Facchiano F (2003)
Active sequences collection (ASC) database: a new tool
to assign functions to protein sequences. Nucleic Acids
Res 31, 379– 382 .
40 Kalinin A, ...
... and
interpretation, manuscript writing; GMH: collection and/
or assembly of data, data analysis and interpretation,
manuscript writing; CA: collection and/or assembly of
data, data analysis and ... interpretation, manuscript writing;
RS: data analysis and interpretation, manuscript writing.
All authors read and approved the final manuscript.
Additional material
Acknowledgements
The authors are ... Martin-Henao
4
, Carmen Azqueta
4
and
Ramon Segura
2
Address:
1
Departament de Fisiologia - Biologia, Universitat de Barcelona, Av. Diagonal, 645 E- 080 28 Barcelona, Spain,
2
Departament de Ciències...
... Med 2004, 45:272-2 78.
19. Uchida K, Nakajima H, Miyazaki T, Yayama T, Kawahara H, Kobayashi S,
Tsuchida T, Okazawa H, Fujibayashi Y, Baba H: Effects of Alendronate on
bone metabolism in glucocorticoid-induced ... 29:1354-1359.
doi:10.1 186 /2191-219X-1-4
Cite this article as: Cook et al.:
18
F-fluoride PET: changes in uptake as a
method to assess response in bone metastases from castrate-resistant
prostate cancer patients treated with
223
Ra-chloride ... ALP changes. Mean SUVmax, PSA and ALP changes at 6 and 12 weeks asa percentage of baseline levels in
the five subjects (A to E).
Table 1 Disease extent, measured metastatic sites and changes...
... are to infect new
executables
Metamorphic code is a code that can reprogram itself by translating its own code into a
temporary representation, and then back to normal code again
For example, ... reasons for creatin
g
and
g
spreading malware
ã
Research projects
Viruses have been written as:
ã
Research projects
ãPranks
ãVandalism
ã To attack the products of specific companies
T di ib ... space
ã Files have strange names which are not recognizable
ã Programs act erratically
ã
Resources are used up easily
ã
Resources are used up easily
Prevention is Better than Cure
Do not accept...
... collagen in OF and OA cartilage. Ratio
of aggrecan to type II collagen in the cartilage matrix of OA and OF
femoral heads and comparison between areas (SP and IP). Aggrecan
and type II collagen ... MMP-1 and (b) MMP-3 in articular cartilage from normal
human femoral heads using ELISA. Values were normalised to total sol-
uble protein, which was obtained after proteoglycan extraction and was ... in
normal and in pathologic cartilage, the ratio of aggrecan to
type II collagen was determined by ELISA. This ratio allows
normalisation of data and elimination of variability due to carti-
lage quality,...
... cur-
rently available analgesic and anti-inflammatory drugs are
clearly not adequate therapy. In addition to these classical
available therapies, there are several reports regarding the use
of disease-modifying ... rheumatoid arthritis. While other arthritis medicines attack
symptoms such as inflammation, DMARDs actually treat the
disease.
It has been reported that DMARDs such as AZ, CQ, MTX and
GS play an ... gastric and duodenal injury
after the use of ibuprofen, aspirin, and other nonsteroidal anti-
inflammatory agents. Am J Med 1 984 , 77:19-24.
12. Silva MA, Ishii-Iwamoto EL, Bracht A, Caparroz-Assef...