can t calculate risk in a case control study
Focused and unfocused written corrective feedback on tenses and other types of errors
Ngày tải lên :
30/09/2015, 10:11
... investigated Both qualitative and quantitative approaches are employed in this study Qualitatively, it investigates the role of (individual) learner’s noticing and the relationship between noticing and ... differences with respect to the first draft are calculated for both post-test and delayed post-test Also, the differences between the delayed post-test and the post-test are calculated as well A sample ... 31 At the third stage of this study, the learners were invited to return to the class on the next day for another task The learners were not told that they had to revise their first draft on the...
- 95
- 557
- 0
Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf
Ngày tải lên :
19/02/2014, 17:20
... self-perception is an important factor for seeking orthodontic treatment.4-7 This is the main reason driving adults to seek treatment.8,9 The strongest motivation for adults subjected to orthognathic ... determined that F7 was at the bottom of the table Table IV shows high and positive correlations in the assessment of male and female esthetics Correlation in evaluation o female esthetics was important ... created images, hard tissue normal values were altered in at least two standard deviations Facial profile images were digitally manipulated in the anterior-posterior plane with little or no changes...
- 7
- 708
- 0
English Language Tests-Intermediate level''''s archiveReal Life: Types of Buildings (3) ppt
Ngày tải lên :
25/07/2014, 07:20
... attend classes in order to get a post-secondary education pyramid university shopping mall warehouse 5 .A is a building that houses ancient and historical artifacts and other items of interest These ... a large place that usually has a big building and several runways on it Airplanes fly into and out of these places on a regular basis airport train station ski lodge pyramid 9 .A is a large ... they die graveyard concert hall restaurant mill 7 .A is a very tall, large building that is found in large cities It usually has many floors skyscraper art gallery factory stadium 8.An is a...
- 8
- 335
- 0
báo cáo khoa học: " ''''Who''''s who'''' in two different flower types of Calluna vulgaris (Ericaceae): morphological and molecular analyses of flower organ identity" pdf
Ngày tải lên :
12/08/2014, 03:21
... Forward: TCGACGAGCTGAATAGTCTTGA Reverse: TCGACTAGCCCATAGTGTGGAT 190 CvSEP1 [GenBank:GQ202027] forward: AGCATCATCCTCAATCCCAG Reverse: GATCATTCCGCTCACGTTTT 143 Page 12 of 15 (page number not for ... 'bud-flowering' type display the same staining pattern (Fig 6F) Furthermore, in the wild-type, petals and stamens show a comparable staining pattern and petals consist of an increased amount of cell layers ... suggests a petaloid identity Regarding whorl II organs, all three criteria investigated may be a hint to petaloid identity In contrast, all organs in both perianth whorls of the 'bud-flowering'...
- 15
- 233
- 0
Bơm ECD-V - P - Types of Systems in ECD-V Series
Ngày tải lên :
23/10/2012, 09:09
... operating conditions of the engine and the driving conditions Then, the engine ECU calculates the fuel injection volume and the injection timing that are necessary for operating the engine in an ... timing, consists of sensors (detectors), computers, and actuators 2-1 Outline of Intake Air System After being filtered through the air cleaner, the intake air travels through the turbocharger and ... an optimal state, and actuates the valves The control system can be broadly classified by their electrical components into the following three systems: Sensor system, ECU, and Actuator system...
- 4
- 563
- 2
Báo cáo y học: " Introducing the Critical Care Forum’s ongoing review of medical statistics"
Ngày tải lên :
25/10/2012, 10:45
... in its own right and a medical statistician fully achieves that role only after years of training and practical experience Most academic departments, and also many clinical departments, include ... qualified medical statisticians and they should be consulted as early as possible in the research process Competing interests None declared References Altman DG: Practical Statistics for Medical ... sufficient and it is vital that researchers recognise their own limitations and seek professional advice whenever it is needed, if only for reassurance Medical statistics is a scientific discipline in...
- 2
- 471
- 0
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers
Ngày tải lên :
07/11/2012, 14:44
... what part the language is playing, what it is that the participants are expecting the language to for them in that situation, the symbolic organisation of the text, the status that it has, and ... metaphor from the textual perspective He states that “ grammatical metaphor affects both the ideational and textual structure of the clause since it is a tool for organizing text” ( martin in ... interrogatives and commands as imperatives Textual meanings are concerned with the interaction of interpersonal and ideational information as text in context Lexico-Grammatically textual meanings are realized...
- 53
- 1K
- 3
An investigation into some types of verbal responses to questions in English and Vietnamese conversation
Ngày tải lên :
07/11/2012, 14:54
... which are observed or recorded, along with information about the sex, age, status, situation, culture, relationshipof the interactants The advantage of this method is that it can reveal the linguistic ... different speakers and are related to each other in such a way they form a pair type They call them an adjacency pair The adjacency pair always consists of a first part and a second part The utterance ... Elicitations information/ confirmation/ agreement/ commitment/ repetition/ clarification In characterizing responding acts, Tsui (1994) asserts that not any move following an initiating move is a...
- 42
- 1.1K
- 4
NTC's pocket dictionary of words and phrases part 75
Ngày tải lên :
19/08/2013, 09:17
... out to put thoughts into writing, rather than keeping them in one’s memory writhe ["raID] iv to twist and turn in pain or as though in pain writing ["raIt IN] n making sentences, words, or letters ... something into something to give up on someone or something as a dead loss, waste of time, hopeless case, etc to take a charge against one’s taxes write someone or something up to write a narrative ... of anxiety; a fear of trouble (Plural only for types and instances.) n someone or something that causes Q tv to be anxious that something bad might happen; to suspect, regrettably, that something...
- 10
- 798
- 3
CO2e emissions from HVAC equipment and lifetime operation for common U.S. building types
Ngày tải lên :
05/09/2013, 15:28
... information on the economical transaction of materials and manufactured goods to estimate the total emissions of a particular sector due to those activities Using an estimated monetary amount spent ... Interconnection encompasses the vast area from the area east of the Rocky Mountains to the Atlantic coast of the United States, including some parts of Texas The Western Interconnection covers most area ... used in the computation This cost included the contractor’s overhead and profit, but not the cost of site work, architectural fees and land cost In addition, the median area cost was the national...
- 12
- 484
- 0
Types Of Interviews
Ngày tải lên :
17/10/2013, 01:15
... Conversational interview These are most closely related to the traditional style of interviewing They appear to be in a more comfortable, relaxed setting but not be fooled, these meetings are still ... in a professional environment and applicants should conduct themselves accordingly Casually asking about the interviewer’s hockey puck on his desk is okay but describing the wacky events at the ... interviewer’s hockey puck on his desk is okay but describing the wacky events at the last game you attended, is not ...
- 2
- 402
- 0
Take Care of Error Handling with Bound Controls
Ngày tải lên :
28/10/2013, 19:15
... Perform the requested task at the dataset ' level using the data adapter odaCustomerIndividual.Update(dsCustomerIndividual, "Customers") '- By accepting the changes, the data gets sent back to the ... the requested task at the dataset ' level using the data adapter odaCustomerIndividual.Update(dsCustomerIndividual, "Customers") '- By accepting the changes, the data gets sent back to the server ... statement to throw the exception back up to a calling subroutine You can use the When clause on the Catch statement to trap for specific exceptions When multiple Catch statements are used, each...
- 6
- 250
- 0
Bias - Types of bias
Ngày tải lên :
01/11/2013, 11:20
... my italic) Hill is referring to bloodletting and all that Galenic harm that doctors had practiced since Christ walked the earth It is worth emphasizing that those who cared about statistics in ... et al., 2003) According to the study abstract: “Mortality data were obtained for all 104 patients years after initiation of the study. ” In those who completed the 12-week study, 48% had died in ... matter of importance is that the randomization needs to be “successful,” by which we mean that as best as we can tell, the two groups are in fact equal on almost all variables that we can measure...
- 14
- 439
- 0
Tài liệu KRONE - the effect of Errors in TCP applications performance (full) pdf
Ngày tải lên :
09/12/2013, 16:15
... result shown below The calculated BCC is inserted in the checksum field in the data packet and transmitted to the receiving station Character Character Character Character Character Character Character ... there is outgoing data, it will "piggy-back" its data on the packet that acts as the acknowledgement In the illustration in the figure above, there is no data to return from Station B So Station ... detection The Three-Way Handshake In order to establish a connection between stations A and B, the A will send a segment to B with a header that has these characteristics: · It contains an initial sequence...
- 12
- 533
- 0