calculation of the specific surface area from isotherms of type i with a multilayer domain and measured below the critical temperature
báo cáo khoa học: "Determination of the volume-specific surface area by using transmission electron tomography for characterization and definition of nanomaterials" docx
... projection requirement is met [4]; (ii) missing wedge artifacts are minimal and (iii) isosurface rendering optimally fits the NM surface Our results indicate that, in principle, the characterization ... characterization and definition of NM can benefit from application of conventional BF ET In the scope of putting this technique in practice for the characterization and definition of gold and silica NM, ... hardly sensitive to radiation damage, extensive data collection using a high frequency of imaging can be applied Because our software and hardware limit the amount of data that can be aligned and reconstructed...
- 8
- 373
- 0
High specific surface area porous sic ceramics coated with reticulated amorphous sic nanowires
... process for the fabrication of high specific surface area porous SiC ceramics, which are coated completely with reticulated amorphous SiC nanowires Commercially available phenolic resin and silicon powders ... This is in accordance with the XRD analysis mentioned above Table lists the data for the obtained high specific surface area porous SiC ceramics coated completely by reticulated SiC nanowires measured ... nanowires are SiC nanowires with a small amount of Fig The representative SEM images ( (a) external surface and (b) fracture surface) of the as-synthesized porous SiC ceramics It can be found that the...
- 5
- 297
- 1
Báo cáo y học: "Sustained remission of rheumatoid arthritis with a specific serotonin reuptake inhibitor antidepressant: a case report and review of the literature" ppsx
... play an important role in modulating inflammatory pain, compared with mechanistic pain Antidepressants have anti-inflammatory and analgesic properties Antidepressants with a dual action (inhibiting ... involved in collating the information, review of literature, and preparation of the manuscript RTK was involved in collating information regarding the case and getting informed consent from the patient ... was referred to a psychiatrist, who started him on escitalopram, a serotonin -specific reuptake inhibitor, at 10 mg/day, and risperidone, an antipsychotic with a serotonin dopamine antagonist action...
- 5
- 318
- 0
báo cáo khoa học: " Complementation of a phycocyanin-bilin lyase from Synechocystis sp. PCC 6803 with a nucleomorph-encoded open reading frame from the cryptophyte Guillardia theta" pot
... Maruyama S, Takahara M, Miyagishima SY, Mori T, Nishida K, Yagisawa F, Yoshida Y, Nishimura Y, Nakao S, Kobayashi T, Momoyama Y, Higashiyama T, Minoda A, Sano M, Nomoto H, Oishi K, Hayashi H, Ohta ... Nishizaka S, Haga S, Miura S, Morishita T, Kabeya Y, Terasawa K, Suzuki Y, Ishii Y, Asakawa S, Takano H, Ohta N, Kuroiwa H, Tanaka K, Shimizu N, Sugano S, Sato N, Nozaki H, Ogasawara N, Kohara ... Strain Nucleotide sequence of orf222 was amplified from Guillardia theta DNA without its putative transit peptide by using the primers 222komp2_f (5'-CAT ATG AAT TAA AAC CAA TCC TTA ATT G -3') and...
- 12
- 221
- 0
Báo cáo y học: "Highly specific inhibition of leukaemia virus membrane fusion by interaction of peptide antagonists with a conserved region of the coiled coil of envelope" potx
... resolution of the pre-hairpin intermediate to the trimer -of- hairpins, thus impairing the fusogenic activity of TM The potency of these inhibitors makes them attractive leads for antiviral therapeutics ... Figure improved inhibitor Substitution of a single arginine residue with alanine yields an Substitution of a single arginine residue with alanine yields an improved inhibitor The syncytium inhibition ... pocket and this interaction appears to contribute substantially to the stability of peptide association with the coiled coil and is required for optimal inhibitory activity The data provides further...
- 14
- 285
- 0
Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx
... wild -type and the K650M mutant receptor was analysed as in (B) A faint biotinylated band is visible with the K650M mutant after and h significant amounts of biotinylated receptor after h Similar ... cotransfecting cells with wild -type or mutant FGFR3 and HA-tagged ubiquitin cDNAs Ubiquitylated receptors identified by blotting with anti-ubiquitin sera appeared as a smear of bands with a lower ... 260-kDa dimer in addition to the monomer The K650M mutant gave only a faint signal with avidin D, consistent with its intracellular retention We then examined endocytosis of the wild -type and mutant...
- 16
- 573
- 0
Báo cáo khoa học: Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions docx
... G A A G G A A G G G A G A A A A A A A A A A A A A A A A A A C G T G T G T T G C G C G G G A G A A G A A A A A A A A A A A A A A A A G A G A T C G T T A T A X00973 AL353732 AL353732 AL353732 X02955 ... attgctagcgttcacgcgaagttattatcagttg agctagcaaggagaatgtgtatagatttactgtga attgctagctgctgcatgtgctagtctggaaaatg attaagcttgacattaatttagtgggtttcgttca tgcagtatgcagagcgtgtg tctcctcccatctggtccag ttcgtccaggagaaggagca ctgatcaacctaccggaggc ... actttataaactggtaagggcgtagc cgtttttattcacattttcaatgttattttttcat attaagcttgctgtttgtttcgctgttagttttc attgctagcaaccaaggcctgtatttattaagca attgctagcagccctgtcaaaactattgactctg attgctagcgttcacgcgaagttattatcagttg...
- 14
- 379
- 0
Báo cáo Y học: Chimeric receptor analyses of the interactions of the ectodomains of ErbB-1 with epidermal growth factor and of those of ErbB-4 with neuregulin potx
... 1114-4, indicating that domain I of ErbB-1 participates somewhat in the EGF binding, in addition to domain III Chimeras 1144-4 and 1444-4, which contain domain I but lack domain III of ErbB-1, ... involved in a lobe of domain I [34] Domain II of ErbB-1 might participate in the ligand interaction as a part of ÔstructuralÕ domain I, or it may support the relative positions between the ligand-binding ... the binding of EGF, in addition to the major contribution of domain III [18] At present, the bivalent manner of EGF binding to the receptor, in which both domains I and III are utilized, is accepted...
- 7
- 450
- 0
báo cáo hóa học:" Whole blood assessment of antigen specific cellular immune response by real time quantitative PCR: a versatile monitoring and discovery tool" potx
... antigens or peptides and the rapid identification of novel antigenic epitopes Classical methods allowing the physical identification and the sorting of cells endowed with peculiar functional profiles ... multimer staining of antigen specific T cells, intracellular staining with cytokine specific antibodies, ELISPOT or ELISA assays for antigen driven cytokine production, antigen specific cytotoxicity ... laboratory facilities Indeed, although the subsequent analysis of cytokine gene expression requires adequate infrastructure, initial antigen stimulation and safe storage and transportation of...
- 9
- 438
- 0
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
... histological subtype and histological grade Information regarding clinical stage was obtained from the medical charts, following the standardized FIGO classification of tumor staging Information ... draft the manuscript MAK assisted with the data collection and helped draft the manuscript IBJ assisted with the statistical analysis JM assisted with data collection and helped to draft the manuscript ... predictive marker in epithelial ovarian cancer Additional material Additional file 1: Expression of the apoptosis regulating proteins Bcl-2 and Bax in A2 780 and A2 780-Cp70 cells and siRBM3 transfected...
- 12
- 531
- 0
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... trained in clinical skills, clinical training skills and advanced training skills, as well as the number of trainings each clinical trainer and advanced trainer had conducted since the training http://www.human-resources-health.com/content/7/1/11 ... were made in alphabetical order of participant surnames If neither the person in charge of VCT services nor the participant was available, the interviewer asked to speak with someone familiar with ... participated in the analysis of the trainer data, as well as contributed to the literature review and writing the article RMcL conducted the analysis of the TIMS data for the external evaluation...
- 8
- 450
- 0
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
... increase the gait variability of healthy older adults; and 3) In patients with a HLGD, diminished lighting significantly increases gait variability In the following paragraphs, we attempt to interpret ... the walking pattern of older adults with a HLGD and cautious gait An elevated risk of falling has been associated with visual impairments, a problem that increases with age [14-17] and fall risk ... interpret these findings and discuss their implications for understanding HLGD, the role of vision in gait, and the relationship between visual impairment and increased fall risk in older adults Perhaps...
- 8
- 415
- 0
Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx
... problem is defined as an individual in a population, codifying each individual with a couple of real-valued vectors: the searched parameters and a standard deviation of each parameter used in the search ... Radar parameters represent the accuracy and quality of available data, while target conditions are the distance and orientation of the flight with respect to radar, motion state of aircraft (uniform ... and Radiocommunications of the same university and is a member of the Data Processing and Simulation Research Group at the Telecommunication School His fields of interest and activity are radar...
- 14
- 342
- 0
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt
... Society's international journals and books, and acts as European distributor for selected publications of the American Association of Petroleum Geologists (AAPG), the Indonesian Petroleum Association ... pedogenetic processes, and implications for ecological risk assessment 63 BA~UELOS, G S & LIN, Z.-O Reuse of agricultural drainage water in central California: phytosustainability in soil with high ... Salem, MA 01970, USA: the item-fee code for this publication is 0305-8719/06/$15.00 British Library Cataloguing in Publication Data A catalogue record for this book is available from the British...
- 5
- 287
- 0
Báo cáo toán học: "The order of monochromatic subgraphs with a given minimum degree" doc
... Ai the y − d vertices of Ai with degree 2(d − 1) in this subgraph and put Ai = Ai \ Ai Color its edges with the color i Now for each j = i we place a bipartite graph whose sides are Ai and Aj ... deleting M and adding the original edges with both endpoints in S Also, add to P all other vertices of V (G) \ (X ∪ S) and all their incident edges Notice that the obtained subgraph is a k-subgraph ... vertices, minimum degree at least k, having an r-coloring of its edges with no monochromatic subgraph larger than the value stated in the theorem Let A1 , , Ar be pairwise disjoint sets of...
- 8
- 310
- 0
Báo cáo toán học: "Asymptotics of the average height of 2–watermelons with a wall" pps
... watermelons with a wall • In appendix A, we summarize background information on – Stirling’s approximation, – certain residues and values of the gamma and zeta function, – a certain double Dirichlet ... Using the representations of the constants ca,b by certain integrals (see (50) in appendix A. 3), we obtain the following approximative asymptotics by numerical integration (carried out with Mathematica) ... residues a of certain Dirichlet series can be obtained in a simple way by using the reciprocity law for Jacobi’s theta function, to Christian Krattenthaler for many helpful discussions, and to the...
- 20
- 319
- 0
Báo cáo y học: "Longitudinal evaluation the pulmonary function of the pre and postoperative periods in the coronary artery bypass graft surgery of patients treated with a physiotherapy protocol" ppt
... group had less mechanical ventilation time, atelectasis, pneumonia and atrial fibrillation as well as a shorter hospitalization time Various studies have confirmed that this therapeutic modality ... the immobility of the thoracic wall This immobility causes superficial breathing, which may result in atelectasis, inadequate ventilation-perfusion ratio and pneumonia These complications lead ... criteria We excluded patients who had a history of previous cardiac surgery, diabetes mellitus, pacemaker implantation, atrial fibrillation, chronic heart failure, utilization of intra-aortic balloon...
- 6
- 471
- 0
Báo cáo y học: "An interesting journey of an ingested needle: a case report and review of the literature on extraabdominal migration of ingested Foreign bodies" pdf
... reviewing the literature on extra-abdominal migration of swallowing foreign bodies, Macchi at al reported a case of a 48-year-old man with esophageal perforation, mediastinitis, and evidence of ... require emergent surgical intervention Ventilation, airway compromise and the risk of aspiration should also be assessed If the swallowed object is radio-opaque, a single frontal radiograph that ... perforation of the ascending aorta during surgical drainage of the mediastinum They reported finding a fish bone under the aortic arch at autopsy [5] Kunishige et al presented a 79-year-old woman...
- 4
- 407
- 0
Báo cáo y học: "A meta-analysis of CAG (cytarabine, aclarubicin, G-CSF) regimen for the treatment of 1029 patients with acute myeloid leukemia and myelodysplastic syndrome" ppsx
... group of patients [2, 7-10] Aclarubicin is an oligosaccharide anthracycline, and an antineoplastic antibiotic It can intercalate into DNA and interact with topoisomerase I and II, thereby inhibiting ... aclarubicin was variable Due to the small sample sizes and ambiguity in reporting the AML status in the studies, it was difficult to ascertain whether the variation of the aclarubicin dosage ... 35 Saito K, Furusawa S, Yamada K, Waga K, Aoyagi A, Koike T, Arimura H, Noguchi M, Yamato H, Sakuma H et al: Comparison of low-dose cytosine arabinoside and aclarubicin in combination with granulocyte...
- 36
- 714
- 0
Báo cáo y học: " Intricacies in the surgical management of appendiceal mucinous cystadenoma: a case report and review of the literature" ppt
... extensive areas of fibrosis and patchy acute and chronic non -specific inflammation were also seen in the wall of the appendix No significant cytological atypia or invasion of the appendiceal wall ... findings in patients with mucinous cystadenomas include cystic masses with low attenuation, irregular wall thickening and absence of associated appendiceal inflammation [1,7] Mural calcification ... this distinction remains elusive and cannot be established with any degree of reliability if we are to depend solely on physical examination findings and radiological imagings Histopathological...
- 4
- 427
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25