cabazitaxel a novel taxane for the treatment of advanced crpc
A novel algorithm for the reconstruction of an entrance beam fluence from treatment exit patient portal dosimetry images
... in addition to the BEAMnrc code The accommodation of this broad range of code bases was a key part of the design of the software for the clusters Even so, at the moment, the COMSOL package has ... mean value of the system from the average of the simulated particles As the statistical uncertainty of the calculation is dependant only on the number of particle histories run, a simulation may ... in materials of an arbitrary geometry The accelerator head design was based on the head design of the Varian Trilogy series linear accelerator, with a millennium MLC xv Chapter Radiation Therapy...
- 245
- 577
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deficiency...
- 9
- 634
- 0
a novel method for the synthesis of titania nanotubes using
... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al /...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... enhanced reactivity tension These substances also control both towards the toxicants makes them the potential the reduction rate of metal ions and the materials for the decomposition applications agglomeration...
- 12
- 705
- 0
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
... statistical software package (Statview 4.5; Abacus Concept Inc, Berkeley, CA, USA) and expressed as mean ± SEM Groups of data were compared by analysis of variance; the means of groups with variances ... in RA synovitis, because most of the leukocytes infiltrating the SF of rheumatoid joints are PMNs PMNs in the RA SF are in an activated state, and produce a variety of other inflammatory mediators ... angiogenic factor, namely vascular endothelial growth factor, was markedly induced by the interaction of FLS with synovial leukocytes via the integrin/ICAM-1 pathway [19] Taken together, these data support...
- 8
- 446
- 0
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx
... The mainstay of surgical therapy in primary or metastatic disease is to achieve a complete resection with negative margins [7] Conventional chemotherapy and radiation therapy may have minor adjunctive ... of Cajal [1] They affect mostly males between the ages of 50 and 70, and are usually found incidentally at early stages [1-4] Large or advanced lesions may present with a variety of clinical findings, ... Kubota K, Makuuchi M, Kusaka K, Kobayashi T, Miki K, Hasegawa K, Harihara Y, Takayama T: Measurement of liver volume and hepatic functional reserve as a guide to decision-making in resectional...
- 4
- 454
- 0
Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps
... significant clinical benefits like disease stability in 80% of patients after 2–3 doses of vaccine The mean survival rate was 13 months for melanoma patients and months for renal cell carcinoma patients ... very small prostate tumors This, in association with radical prostatectomy and radiation therapies, has contributed to increasing the curative indexes [2] After several years of primary therapy, ... metaanalyses of ten clinical trials in melanoma patients (167 patients total) These data support mature DCs as the best choice for conducting clinical trials We prepared DC vaccines using allogeneic...
- 7
- 363
- 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... de-innervation of the joint and removal of the entire end-plate receptors that adhere to the bone and capsular tissue Limitations of the current study include a lack of comparison group and lack of blinding ... 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule Li et al treated patients with RFA of the dorsal rami Three patients had durable response after to 16 ... men; mean age 64, range 22-89) were included Length of follow-up was at least years with a maximum of years Location of facet pain was cervical in 45, thoracic in 15, and lumbar in 114 patients...
- 4
- 599
- 0
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt
... PE38) has undergone several early-phase clinical trials for the treatment of B cell malignancies [35–37] These trials have validated the use of CD22 as a target and highlighted several potential ... of the majority of domain Ia (D1–250) and a portion of domain Ib (D365–380) from native PE Several RITs incorporating a 38 kDa fragment of PE are in preclinical evaluation or have already reached ... of PE and its intoxication pathway have fueled the translation of basic research into clinical therapies that have the opportunity to make a large positive impact on human health High expectations...
- 18
- 528
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... Institute, Oakland, CA, USA for performing GC/MS analyses, and Professor Walter Miller, University of California, San Francisco for the gift of N-62 StAR protein and StAR protein antiserum The excellent ... (lane 3) Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was and lg for placenta (lanes...
- 11
- 475
- 0
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc
... with adjunctive therapy or the actual exercise dosage is the critical factor is unclear The optimal length of treatment and the number of treatment episodes could be useful information for the marketing ... quantity and quality of the educational information about the condition and PFM function The impact of these factors on the outcome of treatment has yet to be evaluated Furthermore, it has been ... Hay-Smith (2002) A A = available in English only as abstract; a = According to Australian National Health and Medical Research Council Hierarchy of Evidence (1998); b = Mean age (SD) unless otherwise...
- 28
- 738
- 0
báo cáo hóa học:" Is tension band wiring technique the "gold standard" for the treatment of olecranon fractures? A long term functional outcome study" docx
... parallel 1.8 mm Kirschner wires from the tip of the olecranon and a 18 gauge wire in a figure -of eight fashion Major intraoperative goal was the perforation of the ulnar Mayo Classification for ... Visual Analogue Scale (VAS) patient satisfaction score (b) the intramedullary pin The above hypothesis wasn't confirmed by Paremain et al [22] as the results of their biomechanical study indicated ... olecranon fracture Mayo Type IIA fracture of the left olecranon after a fall in a 52-year-old woman (A) Lateral (B) and anteroposterior radiographs (C) at years postoperatively showed signs of...
- 6
- 492
- 0
báo cáo hóa học:" The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report" doc
... is a chance of intra-articular pin placement, causing septic arthritis and a risk of damaging the growth plate An external fixator is also used for the treatment of paediatric supracondylar fractures ... this article as: Lam et al.: The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report Journal of ... the site, the pattern of the fracture and its associated injury When treating the displaced supracondylar fracture, the traditional method of traction may fail due to the unbalanced pull of the...
- 6
- 438
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients, ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as...
- 7
- 531
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx
... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients, ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as...
- 7
- 802
- 0
Báo cáo y học: "A 12 Week, Open Label, Phase I/IIa Study Using Apatone® for the Treatment of Prostate Cancer Patients Who Have Failed Standard Therapy" pps
... study Additional studies appear warranted for the use of Apatone as a co–adjuvant, or for emerging salvage chemotherapy in the treatment of late stage prostate cancer Acknowledgements This research ... fit analysis was used to measure and compare PSA values before, during and after therapy.12 Prostate cancer patients who had failed standard therapy were enrolled at William Beaumont, Royal Oak, ... of prior chemotherapy regimens was two Table Patient Characteristics N = 17 Age: median (range) AUA Symptom Score: median (range) Race: Caucasian African American Prior therapies (1 or more treatments):...
- 6
- 510
- 0
Báo cáo y học: " Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report" pot
... patient, a Caucasian woman aged 28 years with a DSM-IV diagnosis of unipolar depression, was enrolled in the acute and long-term phases of the pilot study of VNS therapy for TRD At acute-phase study ... Date of Assessment The patient's score on the CGI-S scale also indicated a substantial improvement after the initiation of VNS therapy Figure The patient's score on the CGI-S scale also indicated ... scales [24] After a year of follow-up, adjunctive VNS therapy was associated with sustained symptomatic benefit and sustained or enhanced functional status [25] Because pregnancy was a contraindication...
- 7
- 453
- 0
Báo cáo y học: "Deep transcranial magnetic stimulation for the treatment of auditory hallucinations: a preliminary open-label study" pptx
... SANS and amelioration of auditory hallucinations Loo et al [19] noted that examinations of individual-controlled trials reveal that a substantial proportion of rTMS studies for the treatment of ... Ya’akov Mental Health Center and is paid by the research fund of the Beer Ya’akov Mental Health Center KM serves as the director of the Beer Ya’akov Mental Health Center ZA works at the Department ... Department of Neurobiology of the Weizmann Institute of Science and also serves as a research consultant for Brainsway DP is head of the research department of Beer Ya’akov Mental Health Center and head...
- 6
- 484
- 0
báo cáo khoa học: "Surgical perspectives from a prospective, nonrandomized, multicenter study of breast conserving surgery and adjuvant electronic brachytherapy for the treatment of breast cancer" pps
... shortened radiation treatment time (86%) and delivery of radiation to a smaller area of the body (77%) Twelve of the patients (27%) indicated that having a local treatment facility was a factor in their ... for treatment Factors affecting the success of implanting the balloon applicator and administering the prescribed radiation therapy were analyzed Patients answered a questionnaire after implantation ... applicable regulations The patient selection criteria were based on the Page of 10 American Society of Breast Surgeons Consensus Statement for Accelerated Partial Breast Irradiation and the American...
- 10
- 389
- 0
Báo cáo khoa học: " Optimal organ-sparing intensity-modulated radiation therapy (IMRT) regimen for the treatment of locally advanced anal canal carcinoma: a comparison of conventional and IMRT plans" ppsx
... N2-3/T4 group Arm A, blue; arm B, brown; arm C, yellow; arm D, green Discussion Concurrent chemoradiation is the established standard of care for locally advanced carcinoma of the anal canal Attempts ... Radiation Oncology 2007, 2:41 http://www.ro-journal.com/content/2/1/41 Background The standard of care for the curative treatment of anal canal carcinoma has evolved over the past three decades, ... Impact of overall treatment time on local control of anal cancer treated with radiochemotherapy Oncology 2003, 65:14-22 Hughes LL, Rich TA, Delclos L, Ajani JA, Martin RG: Radiotherapy for anal...
- 11
- 402
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25