ca2 c and ca 2 m in rpe cells
Báo cáo khoa học: Glutathione transferases kappa 1 and kappa 2 localize in peroxisomes and mitochondria, respectively, and are involved in lipid metabolism and respiration in Caenorhabditis elegans pot
... mouse Toxicol Appl Pharmacol 194, 29 6–308 23 Fernandez-Canon JM, Baetscher MW, Finegold M, Burlingame T, Gibson KM & Grompe M (20 02) Maleylacetoacetate isomerase (MAAI ⁄ GSTZ)-deficient mice reveal ... from 110 to 22 0 C at a rate of C min)1 and the carrier gas was hydrogen (0.5 bar) The injector and detector were maintained at 22 5 and 24 5 C, respectively Finally, lg of glyceryl triheptadecanoate ... In brief, control and RNAi strain cultures were grown for h in LB medium containing 100 mgÆmL)1 ampicillin, and then spread onto NGM agar containing isopropyl thio-b-dgalactoside (1 mm) and carbenicillin...
- 11
- 380
- 0
Báo cáo khoa học: Expression of heme oxygenase-1 is repressed by interferon-c and induced by hypoxia in human retinal pigment epithelial cells pot
... respectively ARPE-19 cells were cultured in a : mixture of DMEM and nutrient mixture F 12 containing 10% fetal bovine serum, mM L-glutamine, and antibiotics (100 UÆmL)1 penicillin and 0.1 mgÆmL)1 ... streptomycin) [37] D407 cells were cultured in DMEM containing 10% fetal bovine serum, mM L-glutamine and antibiotics (at the same amounts as above) [38] Cells were cultured at 37 C under 5% CO2 and ... M Hjelmeland (Department of Biological Chemistry, University of California, Davis, CA, USA) and R C Hunt (Department of Microbiology, University of South Carolina Medical School, Columbia, SC,...
- 9
- 420
- 0
Báo cáo hóa học: " The synergistic effect of IFN-α and IFN-γ against HSV-2 replication in Vero cells is not interfered by the plant antiviral 1-cinnamoyl-3, 11-dihydroxymeliacarpin" pptx
... essential medium supplemented with 5% inactivated calf serum (MEM 5%) and gentamycin (50 μg/ml) at 37 C in 5% CO2 and maintained after monolayer formation in MEM supplemented with 1.5% inactivated calf ... meliacina sobre el curso de la infección herpética genital murina [abstract] Medicina 20 04, 64(Suppl II):337 Courrèges MC, Benencia F, Coto CE, Massouh EJ, Coulombié FC: In vitro antiphagocytic ... surviving cells was determined at 12, 24 , 36 and 48 h p.i (Figure 2c) A comparison of Figure 2b and 2c shows that in the presence of CDM alone Vero cells were highly protected from HSV -2 cytopathicity,...
- 10
- 544
- 0
Báo cáo lâm nghiệp: "Environmental control of CO assimilation rate and leaf 2 conductance in two species of the tropical rain forest of French Guiana (Jacaranda copaia D. Don and Eperua falcata Aubl.)" pdf
... depletion cycle occurring during the dry season, with the gas exchange of E falcata remaining unaffected (Fig 4), whereas both A and g were markedly reduced in J copaia ferently Surprisingly, in the ... slightly increasing, calculated intercellular C0 concentrations (Fig 2) , thus indicating that the changes in A are primarily due to alterations of mesophyll photosynthesis (Jones, 1985) The midday depression ... during the afternoon Midday depression cannot entirely be taken into account by the concurrent stomatal closure, since in the J copaia leaflets, A decreased at constant, or even slightly increasing,...
- 5
- 324
- 0
Báo cáo y học: " Tenascin-C and alpha-smooth muscle actin positive cells are increased in the large airways in patients with COPD" pot
... by immunohistochemistry in each case Immunohistochemical stainings for Tn -C and a-SMA was performed in serial sections, i.e in consecutive sections Staining for desmin was done in 44 of the most ... stainings for desmin, 17 cases were spindle shaped cells positive both for a-SMA and desmin, and 15 cases were spindle shaped cells positive for aSMA but negative for desmin In the remaining 12 ... wall, staining for desmin; scale bar = 0.05 mm E: Staining for vimentin from a case in which no a-SMA or desmin positive spindle shaped cells were found Positive staining pattern in normal fibroblasts...
- 11
- 431
- 0
Tài liệu Báo cáo khoa học: Collagen I regulates matrix metalloproteinase-2 activation in osteosarcoma cells independent of S100A4 pdf
... recombinant TIMP-1 present Activation of MMP -2 by recombinant MT1-MMP Activation of MMP -2 by MT1-MMP was performed by incubating human recombinant MMP -2 (3 lgÆmL)1; 42 nm) with human recombinant ... TIMP-1 Human recombinant proMMP -2 (3 lgÆmL)1; 42 nM) was incubated for 24 h at 37 C with membranes isolated from colchicine treated pHb-1 cells or recombinant human MT1-MMP catalytic domain in ... recombinant MT1-MMP catalytic domain (4 lgÆmL)1; 20 0 nm) in the absence and presence of recombinant TIMP-1 (0.588 2. 3 52 lgÆmL)1; 21 –84 nm) for 24 h at 35 C in 50 mm Tris ⁄ HCl, pH 8.0, mm CaCl2, 0.005%...
- 12
- 572
- 0
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx
... 0.9– 1 .2 · 109 NaCl/Pi-washed Jurkat cells at C for h in 25 mL of 20 mM Tris/HCl, pH 7.6, 150 mM NaCl, mM MgCl2, mM b-mercaptoethanol, 0.5% (v/v) Triton X-100, mM Pefabloc and Complete (Roche Diagnostics), ... washes with NaCl/Pi containing 0.3 M NaCl, the fluorescence intensity was measured by flow cytometry Confocal microscopy Indirect immunofluorescence staining and confocal microscopy were used to visualize ... washing with NaCl/Pi containing 1% BSA, cells were examined using an LSM 510 confocal microscopic system (Carl Zeiss, Esslingen, Germany) Procedures used to evidence capping of surface nucleolin...
- 15
- 509
- 0
Báo cáo Y học: Concerted regulation of free arachidonic acid and hormone-induced steroid synthesis by acyl-CoA thioesterases and acyl-CoA synthetases in adrenal cells pdf
... primary antibody at C Bound antibodies were detected by chemiluminescence using the ECL kit (Amersham Pharmacia Biotech) (Calbiochem, CA, USA) and examined in an Olympus BX 50 epifluorescence Microscope ... and 22 R-OH-cholesterol were purchased from Sigma Chemicals Co., St Louis, MO, USA Triacsin C was from BIOMOL Research Laboratories Inc (Plymouth Meeting, PA, USA) and Ham-F10 cell culture medium ... Toronto, Canada), were maintained in Ham-F10 medium, supplemented with 12. 5% heat-inactivated horse serum and 2. 5% heat-inactivated fetal bovine serum, 1 .2 gÆL)1 NaHCO3, 20 0 IUÆmL)1 penicillin and 20 0...
- 9
- 470
- 0
Báo cáo khoa học: Sugar signalling and antioxidant network connections in plant cells pptx
... biosynthesis) and anthocyanins Both anthocyanins and phenolic compounds might be involved in the scavenging of cytosolic ROS, creating phenolic compound radicals (phenolic compounds•), which are reduced ... Dickman MB (20 04) Bcl -2 family members localize to tobacco chloroplasts and inhibit programmed cell death induced by chloroplast-targeted herbicides J Exp Bot 55, 26 17 26 23 FEBS Journal 27 7 (20 10) ... DNA damage causes mitochondrial genomic instability in Saccharomyces cerevisiae Mol Cell Biol 25 , 5196– 520 4 71 Asada K (1999) The water cycle in chloroplasts: scavenging of active oxygen and dissipation...
- 16
- 610
- 0
Báo cáo khoa học: Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells ppt
... SR-A CD36 SR-B1 ACAT1 DGAT1 ABCA1 GAPDH AGTTGGCTGCGTTAATGTGAC CCCAGGTGTCTACCATCACAC TTCCTCACACTGGCACTTGTA GGGGTTGTAGAGTTCCAGGTC ATTGCCCTTTACCTCCTCGT AGATGCAGCCTCATTTCCAC ATGAGGTTGGCTTCCATGTC TGGGTTTTCAACTGGAGAGG ... TGGGTTTTCAACTGGAGAGG GAAACTGCAGCTGAGCCTCT ACCTACTTGGCTCCGGATTT CTACAAGGCAGGCAGTATTGG CCTGTGTTGAGGGAGTACCTG TAAGCGTCCTGTTCATTTCGT GGGCGAAACCAATGTATTTCT AACAGTTTGTGGCCCTTTTG AATGACCCCTTCATTGACCTC AGTTCCAGGCTGGGGTACTT ... AGTTCCAGGCTGGGGTACTT GTTCACACCCATGACGAACAT 343 326 24 8 175 25 0 334 328 157 309 Ó FEBS 20 04 24 20 E H Moore et al (Eur J Biochem 27 1) CRLPs and cell samples was determined by enzymatic analysis using...
- 11
- 291
- 0
Báo cáo khoa học: Dictyostelium differentiation-inducing factor-1 induces glucose transporter 1 translocation and promotes glucose uptake in mammalian cells pdf
... Kubohara Y (20 04) DIF-1 promotes glucose uptake in mammalian cells 20 21 22 23 24 25 26 27 28 29 30 31 Calmodulin-dependent cyclic nucleotide phosphodiesterase (PDE1) is a pharmacological target ... the effects of DIF analogs and thapsigargin (Tg) on [Ca2 + ]c in 3T3-L1 cells As shown in Fig 6, DIF-1 at 20 lm indeed increased [Ca2 + ]c, while THPH showed no significant effect on [Ca2 + ]c Importantly, ... [Ca2 + ]c- increasing agents, thapsigargin (an inhibitor of Ca2 + -ATPase present in endoplasmic reticula) and A23187 (a calcium ionophore), and 8-methoxymethyl-3-isobutyl-1-methylxanhine (8-MIBMX;...
- 13
- 430
- 0
Báo cáo khoa học: DYRK1A phosphorylates caspase 9 at an inhibitory site and is potently inhibited in human cells by harmine pptx
... bovine serum, 50 UÆmL)1 penicillin, 50 lgÆmL)1 streptomycin and mm l-glutamine (Invitrogen, Carlsbad, CA) For U2 .C9 – C2 87A cells [18], which stably express catalytically inactive caspase 9 (C2 87A), ... NLS-Casp9 NLS-Casp9 GFP-Casp9 DNA Casp9 GFP NES-Casp9 EV NES-Casp9 FLAGDYRK1A C NES-Casp9 B p-Casp9 (T 125 ) GFP-Casp9 Actin NES-GFP-Casp9 FLAG D Casp9 NLS-GFP-Casp9 p-Casp9(T 125 ) GFP-Casp9 Actin Fig ... p-ERK1 /2 ERK1 /2 Actin Actin M) – – D M) 0.1 50 Flag Actin – -caspase-9 – – F EV p-Casp9(T 125 ) Casp9 FLAG-DYRK1A Harmine Inhibitor ( M) Casp9 – – PA p-Tyr Actin Input – – Casp9 Mock Harmine( M) 10...
- 13
- 317
- 0
Báo cáo hóa học: " Subcellular forms and biochemical events triggered in human cells by HCV polyprotein expression from a viral vector" doc
... HCV infected chimpanzees or in human hepatocellular carcinoma (HCC) samples [25 27] In contrast, it was reported that GSTM1 null genotype may facilitate HCV infection becoming chronic [28 ], and ... positive control) The cytochrome c release was detected by confocal microscopy As shown in Fig 5A, the cytochrome c remained confined to the mitochondria in both uninfected cells and VT7-HCV7.9infected ... virus infection in vitro Proc Natl Acad Sci USA 20 05, 1 02: 929 4- 929 9 Moss B: Vaccinia virus: a tool for research and vaccine development Science 1991, 25 2:16 62- 1667 Moss B: Genetically engineered...
- 20
- 621
- 0
Báo cáo khoa hoc:" Lack of effects of typical and atypical antipsychotics in DARPP-32 and NCS-1 levels in PC12 cells overexpressing NCS-1" doc
... antipsychotics modulate schizophrenia symptoms, the molecular and biochemical mechanisms implicated in this improvement is not well established Because of the functions of both DARPP- 32 and NCS-1 in ... Neurosci 20 02, 22 :8476-86 Negyessy L, Goldman-Rakic PS: Subcellular localization of the dopamine D2 receptor and coexistence with the calcium-binding protein neuronal calcium sensor-1 in the primate ... occupy D2 receptors, clozapine occupies D4 Neuropsychopharmacology 19 92, 7 :26 1-84 Bergson C, Levenson R, Goldman-Rakic PS, Lidow MS: Dopamine receptor-interacting proteins: the Ca( 2+ ) connection in...
- 7
- 244
- 0
Báo cáo y học: " Identification of biomolecule mass transport and binding rate parameters in living cells by inverse modeling" ppt
... 20 02, 29 8:1 623 -1 626 Carrero G, McDonald D, Crawford E, de Vries G, Hendzel MJ: Using FRAP and mathematical modeling to determine the in vivo kinetics of nuclear proteins Methods 20 03, 29 :14 -28 ... fitting methods, one cannot draw conclusions regarding binding reaction, slow or rapid mobility of biomolecules, and concentrations of free macromolecule, vacant binding sites and bound complex inside ... Biology and Medical Modelling 20 06, 3:36 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 Tardy Y, McGrath JL, Hartwig JH, Dewey CF: Interpreting photoactivated fluorescence...
- 19
- 386
- 0
Báo cáo y học: "Segmentation-based detection of allelic imbalance and loss-of-heterozygosity in cancer cells using whole genome SNP arrays" ppsx
... (b) q21.3 q 22. 2 q23.1 q23.3 q24. 12 q21.3 q 22. 2 q23.1 q23.3 q24. 12 q24 .21 q24 .23 q21.3 q 22. 2 q23.1 q23.3 q24. 12 q24 .21 q24 .23 q24 .23 q21.11 q21.13 q21.11 q21.13 q21.11 q21.13 q24 .21 p11 .21 q11.1 ... R136.3 q24 .23 q21.3 q 22. 2 q23.1 q23.3 q24. 12 q24 .21 q24 .23 p21.1 p21.1 q21.11 q21.13 p21.3 p21.3 p11 .21 q11.1 q11 .22 q 12. 1 q 12. 3 q13 .2 p23.1 p23.1 p11 .21 q11.1 q11 .22 q 12. 1 q 12. 3 q13 .2 p23.3 Log ... the breast cancer cell line CRL -23 24 [21 ] hybridized on HumanCNV370 Genotyping BeadChips Genomic DNA from CRL -23 24 and its matched normal cell line (CRL -23 25) was obtained from ATCC [25 ] Dilutions...
- 18
- 284
- 0
The study of interactions of transmembrane receptors and intracellular signaling proteins in live cells by fluorescence correlation and cross correlation spectroscopy
... molecules molecular brightness, counts per molecule per second wavelength microsecond microwatt two-dimensional and three-dimensional xi ACF Ack APC BRET BSA CaM CaMKII CCD CCF Cdc 42 CFP CLIP CNS Co-IP ... techniques to identify protein-protein interactions include crosslinking, coimmunoprecipitation (co-IP) and copurification by chromatography Chemical cross-linking and co-IP are classical methods ... Cdc 42- associated tyrosine kinase adenomatous polyposis coli bioluminescence resonance energy transfer bovine serum albumin calmodulin Ca2 + /CaM-dependent protein kinase II charge-coupled devices cross-correlation...
- 173
- 360
- 0
A multiplex comparative proteomic analysis of hypoxia influence in the presence and absence of p53 in HCT116 cells
... damage that can be caused by exposures to carcinogens and/ or mutagens Carcinogens are cancer-causing agents (e.g asbestos, cigarette smokes, acrylamide, etc.) and typically, mutagens are carcinogenic ... development of cancer In cancer, the microenvironment plays an important part in affecting cancer progression as well as cancer treatment The presence of hypoxic microenvironment is a common phenomenon ... lumps, blood tests, computed tomography (CT) scan, and tumor biopsy An example of cancer markers is carcinoembryonic antigen (CEA) used for detecting 13 several types of cancer (such as gastrointestinal,...
- 134
- 287
- 0
Báo cáo khóa học: Phospholipase C, protein kinase C, Ca 2+ /calmodulin-dependent protein kinase II, and redox state are involved in epigallocatechin gallate-induced phospholipase D activation in human astroglioma cells ppt
... rise in [Ca2 + ]i in U87 cells As EGCG stimulates PLC activity, it might induce an increase in [Ca2 + ]i in U87 cells [Ca2 + ]i after EGCG treatment was visualized by loading the cells with Fura -2/ EGCG ... increase in [Ca2 + ]i The EGCG-evoked increase in [Ca2 + ]i was inhibited by the nonspeci c Ca2 + channel inhibitor lanthanum, and the PLC inhibitor U73 122 , but not by pretreatment with the L-type Ca2 + channel ... confocal immunofluorescence microscopy, we confirmed that PLC -c1 translocation to membrane regions increased after EGCG treatment Furthermore, colocalization of PLD1 and PLC -c1 increased in the membraneous...
- 11
- 279
- 0
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf
... unspecified Ca2 + entry channels [24 ], we measured its contribution to thrombin-induced Ca2 + signals in the presence or absence of external CaCl2 Typically, ADP increased and prolonged the Ca2 + response ... words, the combined antagonism of PKA and PI3-K was sufficient to almost completely block the effect of ADP ⁄ P2Y 12 on thrombin-induced Ca2 + mobilization P2Y 12 stimulation increases Ca2 + mobilization ... phospholipase C activity The PI3-K pathway might enhance Ca2 + mobilization by reducing Ca2 + removal via sarco- and endoplasmic reticulum Ca2 + -ATPase (SERCA) inhibition, in a similar way to that...
- 15
- 565
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008