... topological binding mode of the HD and in uence the nucleotide contacts made by the recognition helix [6] Notably, these different binding modes seemed to depend on thebinding site sequence, and thebinding ... previously reported Six3 -binding sequence (TGATAC), we observed similar binding affinity, suggesting that the Six3 HD has several binding modes with distinct DNA -binding specificities Using several experimental ... that intramolecular interactions involving residues outside of the protein–DNA binding interface can also in uence DNA recognition [10,40] In particular, variations inthe position of the N-terminal...
... However, coordination with 6, or even up to 12 atoms is also possible A helix-loop-helix structural domain constituting the Ca2+ binding motif is found in a large number of Ca2+ -binding proteins, and ... known as the EF hand [16] Proteins containing the EF hand are divided into two classes according to their functions: signaling and buffering ⁄ transport proteins The former undergoing Ca2+ -dependent ... raising the temperature from 273 to 323 K The increase in spectral shift or bandwidth in response to the increase in temperature may indicate the involvement of more thermally populated excitonic states...
... actin -binding sites, is in interaction with the C-terminal a-helix of G6 domain The sequence 159–193, including the second actin interface, appears also in interaction with G6 domain Therefore, ... domain Footprint of G2 on gelsolin G4–6 domain Two sites within the G2 domain appear involved inthe G2- G4–6 interface inthe presence of EGTA (Fig 3) The interaction of these two sites (residues ... 0.5–0.8 lM) in EGTA, weaker binding was evident inthe presence of mM calcium (Fig 5) In addition a change inthe interface occurs during calcium binding to IIG6 site (Fig 6) The interaction...
... of the Lectin -binding Sitesinthe Equine Vomeronasal Organ 17 Fig Histochemical staining of DBA (A and B), SBA (C and D), and Isolectin B4 (E and F) inthe vomeronasal sensory epithelium of the ... Microvilli Receptor cell Supporting cell Basal cell Glands DBA + ++ - - - SBA + - - - - -, No binding; +, infrequent (66% binding Lectin Isolectin B4 WGA + ++ - ++ - - - - - ... consisted of the receptor, supporting cells, and basal cells The J acobson's glands were situated inthe lamina propria Since the ducts of these glands penetrated the epithelium and opened into the VNO...
... and the following primers: inthe first PCR reaction the outer adapter (5'GCTGATGGCGATGAATGAACACTG3') was combined with the gene specific outer primer (5'CAGCAGCACTTTGGGGATGTTGAG3'), inthe second ... amino acid insert and the KTS insert inthe zinc finger region, did not influence GP210 expression in SAOS osterosarcoma cells, in a system using tetracycline-induced repression of expression In ... determine whether the putative WT1 bindingsitesinthe GP210 promoter might correspond to functional reg- The present study describes the genomic structure of the human nucleoporin GP210 gene, including...
... in lectins and haemagglutinin) where Carbohydrate bindingsitesin Candida exoglucanase shallow indentations contrast with the deeper clefts found inthe active sites of carbohydrate processing ... polymers The nature of the aromatic residues inthe two triads might then be reflecting the different functional constraints for the two proteins: Exg requiring precise positioning of laminarin substrate ... provides an insight into the enzyme’s mechanism of action inthe C albicans cell wall Finally, the unexpected discovery of an isolated binding site remote from the active site poses the intriguing possibility...
... Characterization of the C/EBP binding sequences inthe CYP3A1 promoter region We used gel mobility-shift assays, with the goal of identifying active C/EBPa bindingsites within the CYP3A1 locus ... manufacturer The oligonucleotides used for site-directed mutagenesis of the C/EBP bindingsites were as follows (mutated bases underlined): site 3A1-300: 5¢-GGAGA AAGTCCGTCTATGGTGGTGTGCAGATGACACAG TTTTGGC-3¢; ... oligonucleotides encompassing the two distinct CYP3A1 5¢ sites 3A1-300 ()350/)331, 5¢GTCCTTCTGTAATGGTGTG-3¢), or 3A1-600 ()629/ )608, 5¢-TGCAGGATTGCAGAAGTCTATT-3¢) These were ligated with the SmaI-digested...
... the Ca2+ -binding site and plays a crucial role in interacting with the Ca2+ ions at both bindingsites [18] This may therefore account for the effects of 2-APB on Ca2+ binding Also close to the ... absence and 45 Ca2+ binding to the ATPase To deduce whether 2-APB was directly affecting Ca2+ binding, 4 5Ca2+ binding experiments were also performed on the purified ATPase (Fig 5) Thebinding curves ... both reducing the rate constant for binding as well as increasing the rate constant for Ca2+ dissociation, could be explained by 2-APB binding to either one or both of these sitesIn summary,...
... micro-environments Moreover, we expect the "best growth" to occur inthe unsprayed 25% crown cover plots in future years Thus far the seedlings in these plots are the tallest seedlings inthe study, and even greater ... considering the recent restrictions on the use of herbicides inthe US It also reinforces the importance of selecting sites where understory competition is minimal while at the same time providing adequate ... of competing vegetation and to seedling dieback caused by a late spring frost in 1992 Herbicide spraying temporarily reduced the density of competing vegetation inthe clearcut during the first...
... b-cyclodextrin injection, and the bottom panel depicts thebinding isotherm; open circles represent the integrated binding heat of the data inthe top panel, and the full line is the fit of a one-site binding ... AtAMY3 in vitro It cannot be precluded that some binding may involve secondary bindingsitesinthe catalytic domain, but the demonstrated starchbinding ability of different isolated CBM45s used in ... carbohydrate -binding module of glucoamylase from Rhizopus oryzae consists of two sites Starch -binding domains inthe CBM45 family 35 36 37 38 39 40 41 playing distinct roles in ligand binding Biochem...
... Furthermore, the region involved in G-protein interactions is more conserved in all the organisms than the other functional domains of the protein We compared the Ca2+ -binding and Mg2+ -binding ... occurring in Calnuc upon metal ion binding Ca2+ and Mg2+ binding lead to an increase inthe fluorescence intensity of the tryptophans in an ion-dependent fashion Ca2+ binding leads to a two-fold increase ... between proteins classically known to adopt the c2 domain for binding to Ca2+ and Calnuc In proteins containing c2 domains, the Ca2+ -binding sites are formed primarily by the side chains of Asp,...
... cell death [65,66] The AR contains an N-terminal domain harboring activation function 1, a central DNA -binding domain (DBD) and a C-terminal ligandbinding domain (LBD) containing activation function ... ligand -binding domain Actin -binding protein Targeting sequence Gelsolin Direct or indirect association with the AR Region LBD Classes Role inthe cytoplasm AR effect Mechanism ()) Actin filament ... Direct a-actinin-2 ()) Bundling proteins Coactivator Supervillin NLS F-actin- and membraneassociated scaffolding protein Filamin NLS? Cross-linking proteins Filamin A NLS? Cross-linking proteins Transgelin...
... proteins nesprin 1a and nesprin [28,29] Since the different binding regions overlap at least partially, a simultaneous binding of some binding partners may be excluded, giving rise to distinct ... mislocalization of emerin that is caused by the loss of emerin binding to lamin A (X- linked form) or by the loss of lamin A (autosomal dominant form) [22,23] Several emerin binding partners have ... proteins shown to interact with emerin, binding regions were mapped onto the emerin sequence (Fig 5B) The best characterized of these interactions occurs between the DNA ⁄ protein complexes of the...
... reconstituted into POPC, indicating similar membrane embedded coupling ion bindingsites on their enzyme (Fig 5B) The fact that thebinding site of the I tartaricus enzyme is embedded inthe membrane ... buried bindingsites of the c11 rotor ring within a lipid bilayer without the presence of subunit a These results therefore reinforce our model for the rotor ring with 11 intrinsic channels linking ... of thebinding site from the aqueous environment The modication of thebindingsites by DCCD was specically protected by Na+ that conrms the direct access of Na+ to the c subunit sites by intrinsic...
... increasing amounts of DNase show a proportionate increase inthe intensity of the DHS fragments inthe control samples In Fig 7A the forskolin-treated chromatin shows a relative increase inthe ... similar intensity but the DHS in intron 18 is less evident (Fig 5B) In contrast, the DHS in intron 18 is more prominent than those in introns 16 and 17 (Fig 5A) in chromatin from Capan1 cells The ... the pancreatic cell lines Capan1 and NP31 were evaluated further DHS in airway epithelial cells were investigated further inthe airway carcinoma cell line Calu3 Of particular interest were the...
... Poisoning the Well: How the EPA is Ignoring Atrazine Contamination in Surface and Drinking Water inthe Central United States An Atrazine Primer Atrazine is a selective herbicide ... chemicals Poisoning the Well: How the EPA is Ignoring Atrazine Contamination in Surface and Drinking Water inthe Central United States Recommendations for Protecting Human Health and the Environment ... atrazine as well as the presence of atrazine in drinking water Under the Safe Drinking Water Act (SDWA), the EPA has determined that no more than parts per billion (ppb) of atrazine (as a running...
... Characters in bold italics indicate potential Ca2+ -binding sites as compared with those in TG2 The amino acids inthe frames may preclude Ca2+ binding as compared with the homologous sitesin other ... 7091 Ca2+ -binding sites of TG2 ´ly R Kira et al Fig Multiple sequence alignment of Ca2+ -binding sites of transglutaminases Sequence alignments of Ca2+ -binding sites of TG2 compared with the other ... a large number of Ca2+ -binding proteins, not share significant similarities with the Ca2+ -binding motifs of the transglutaminase family Interestingly, TG2 also has a GTP -binding site and can hydrolyze...
... species of the hydrophobicligand -binding protein and solely binds 3-hydroxyretinol as an intrinsic ligand, we termed this protein the Papilio retinol -binding protein (Papilio RBP) Further analysis ... ligand -binding protein inthe fly chemosensory hair [26]) The calculated pI value of the Papilio RBP is 4.92; the protein is highly acidic This explains the high mobility of the protein inthe native ... retinol -binding protein, Papilio RBP We identified a novel type of protein that binds retinol, which we termed the Papilio retinol binding protein (Papilio RBP) The native ligand of this protein...
... provides insight into the inhibitor bindingsitesin HylP2 and postulates the substrate binding regions inthe bacteriophage enzyme as a result of ascorbic acid being structurally similar to the glucuronate ... polysaccharide binding site in HylP2 The conformational changes observed inthe side chains of Glu167 and Lys179 upon binding to ascorbic acid are shown by superimposing their binding regions of ... Phe264 The structures of the complexes of HylP2 indicate the existence of three subsites inthe long concave binding site of the enzyme where lactose and ascorbic acid are located The binding...
... observed changes in B binding free energy using the independent binding model DDGtotal values were calculated based on the independent binding model, whereby independent binding free energies ... putative bindingsites Twenty-three putative bindingsites were obtained (Table 1) Thebinding site for the slr1667–slr1668 operon, which is regulated by SYCRP1, is included among these sites 4788 In ... whether SYCRP1 binds to putative bindingsites or not are shown Eleven putative bindingsites selected in ascending A order of DDGtotal are shown Confirmation of SYCRP1 binding to putative binding...