0

ca2 binding sites in the e2 tg state

Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx

Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx

Báo cáo khoa học

... topological binding mode of the HD and in uence the nucleotide contacts made by the recognition helix [6] Notably, these different binding modes seemed to depend on the binding site sequence, and the binding ... previously reported Six3 -binding sequence (TGATAC), we observed similar binding affinity, suggesting that the Six3 HD has several binding modes with distinct DNA -binding specificities Using several experimental ... that intramolecular interactions involving residues outside of the protein–DNA binding interface can also in uence DNA recognition [10,40] In particular, variations in the position of the N-terminal...
  • 15
  • 349
  • 0
Báo cáo khoa học: Specific Ca2+-binding motif in the LH1 complex from photosynthetic bacterium Thermochromatium tepidum as revealed by optical spectroscopy and structural modeling pdf

Báo cáo khoa học: Specific Ca2+-binding motif in the LH1 complex from photosynthetic bacterium Thermochromatium tepidum as revealed by optical spectroscopy and structural modeling pdf

Báo cáo khoa học

... However, coordination with 6, or even up to 12 atoms is also possible A helix-loop-helix structural domain constituting the Ca2+ binding motif is found in a large number of Ca2+ -binding proteins, and ... known as the EF hand [16] Proteins containing the EF hand are divided into two classes according to their functions: signaling and buffering ⁄ transport proteins The former undergoing Ca2+ -dependent ... raising the temperature from 273 to 323 K The increase in spectral shift or bandwidth in response to the increase in temperature may indicate the involvement of more thermally populated excitonic states...
  • 11
  • 392
  • 0
Báo cáo khoa học: Co-operation of domain-binding and calcium-binding sites in the activation of gelsolin pptx

Báo cáo khoa học: Co-operation of domain-binding and calcium-binding sites in the activation of gelsolin pptx

Báo cáo khoa học

... actin -binding sites, is in interaction with the C-terminal a-helix of G6 domain The sequence 159–193, including the second actin interface, appears also in interaction with G6 domain Therefore, ... domain Footprint of G2 on gelsolin G4–6 domain Two sites within the G2 domain appear involved in the G2- G4–6 interface in the presence of EGTA (Fig 3) The interaction of these two sites (residues ... 0.5–0.8 lM) in EGTA, weaker binding was evident in the presence of mM calcium (Fig 5) In addition a change in the interface occurs during calcium binding to IIG6 site (Fig 6) The interaction...
  • 8
  • 406
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Histochemical Characterization of the Lectin-binding Sites in the Equine Vomeronasal Organ" potx

Báo cáo khoa học

... of the Lectin -binding Sites in the Equine Vomeronasal Organ 17 Fig Histochemical staining of DBA (A and B), SBA (C and D), and Isolectin B4 (E and F) in the vomeronasal sensory epithelium of the ... Microvilli Receptor cell Supporting cell Basal cell Glands DBA + ++ - - - SBA + - - - - -, No binding; +, infrequent (66% binding Lectin Isolectin B4 WGA + ++ - ++ - - - - - ... consisted of the receptor, supporting cells, and basal cells The J acobson's glands were situated in the lamina propria Since the ducts of these glands penetrated the epithelium and opened into the VNO...
  • 5
  • 254
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Despite WT1 binding sites in the promoter region of human and mouse nucleoporin glycoprotein 210, WT1 does not influence expression of GP210" pptx

Báo cáo khoa học

... and the following primers: in the first PCR reaction the outer adapter (5'GCTGATGGCGATGAATGAACACTG3') was combined with the gene specific outer primer (5'CAGCAGCACTTTGGGGATGTTGAG3'), in the second ... amino acid insert and the KTS insert in the zinc finger region, did not influence GP210 expression in SAOS osterosarcoma cells, in a system using tetracycline-induced repression of expression In ... determine whether the putative WT1 binding sites in the GP210 promoter might correspond to functional reg- The present study describes the genomic structure of the human nucleoporin GP210 gene, including...
  • 11
  • 274
  • 0
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Báo cáo khoa học

... in lectins and haemagglutinin) where Carbohydrate binding sites in Candida exoglucanase shallow indentations contrast with the deeper clefts found in the active sites of carbohydrate processing ... polymers The nature of the aromatic residues in the two triads might then be reflecting the different functional constraints for the two proteins: Exg requiring precise positioning of laminarin substrate ... provides an insight into the enzyme’s mechanism of action in the C albicans cell wall Finally, the unexpected discovery of an isolated binding site remote from the active site poses the intriguing possibility...
  • 13
  • 498
  • 0
Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

Báo cáo khoa học

... Characterization of the C/EBP binding sequences in the CYP3A1 promoter region We used gel mobility-shift assays, with the goal of identifying active C/EBPa binding sites within the CYP3A1 locus ... manufacturer The oligonucleotides used for site-directed mutagenesis of the C/EBP binding sites were as follows (mutated bases underlined): site 3A1-300: 5¢-GGAGA AAGTCCGTCTATGGTGGTGTGCAGATGACACAG TTTTGGC-3¢; ... oligonucleotides encompassing the two distinct CYP3A1 5¢ sites 3A1-300 ()350/)331, 5¢GTCCTTCTGTAATGGTGTG-3¢), or 3A1-600 ()629/ )608, 5¢-TGCAGGATTGCAGAAGTCTATT-3¢) These were ligated with the SmaI-digested...
  • 9
  • 425
  • 0
Báo cáo Y học: Inhibition of SERCA Ca2+ pumps by 2-aminoethoxydiphenyl borate (2-APB) 2-APB reduces both Ca2+ binding and phosphoryl transfer from ATP, by interfering with the pathway leading to the Ca2+-binding sites ppt

Báo cáo Y học: Inhibition of SERCA Ca2+ pumps by 2-aminoethoxydiphenyl borate (2-APB) 2-APB reduces both Ca2+ binding and phosphoryl transfer from ATP, by interfering with the pathway leading to the Ca2+-binding sites ppt

Báo cáo khoa học

... the Ca2+ -binding site and plays a crucial role in interacting with the Ca2+ ions at both binding sites [18] This may therefore account for the effects of 2-APB on Ca2+ binding Also close to the ... absence and 45 Ca2+ binding to the ATPase To deduce whether 2-APB was directly affecting Ca2+ binding, 4 5Ca2+ binding experiments were also performed on the purified ATPase (Fig 5) The binding curves ... both reducing the rate constant for binding as well as increasing the rate constant for Ca2+ dissociation, could be explained by 2-APB binding to either one or both of these sites In summary,...
  • 10
  • 412
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "An artificial regeneration system for establishing northern red oak on dry-mesic sites in the Lake States, USA" pptx

Báo cáo khoa học

... micro-environments Moreover, we expect the "best growth" to occur in the unsprayed 25% crown cover plots in future years Thus far the seedlings in these plots are the tallest seedlings in the study, and even greater ... considering the recent restrictions on the use of herbicides in the US It also reinforces the importance of selecting sites where understory competition is minimal while at the same time providing adequate ... of competing vegetation and to seedling dieback caused by a late spring frost in 1992 Herbicide spraying temporarily reduced the density of competing vegetation in the clearcut during the first...
  • 10
  • 294
  • 0
Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-affinity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx

Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-affinity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx

Báo cáo khoa học

... b-cyclodextrin injection, and the bottom panel depicts the binding isotherm; open circles represent the integrated binding heat of the data in the top panel, and the full line is the fit of a one-site binding ... AtAMY3 in vitro It cannot be precluded that some binding may involve secondary binding sites in the catalytic domain, but the demonstrated starchbinding ability of different isolated CBM45s used in ... carbohydrate -binding module of glucoamylase from Rhizopus oryzae consists of two sites Starch -binding domains in the CBM45 family 35 36 37 38 39 40 41 playing distinct roles in ligand binding Biochem...
  • 11
  • 634
  • 0
Báo cáo khoa học: Ion-binding properties of Calnuc, Ca2+ versus Mg2+ – Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein pdf

Báo cáo khoa học: Ion-binding properties of Calnuc, Ca2+ versus Mg2+ – Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein pdf

Báo cáo khoa học

... Furthermore, the region involved in G-protein interactions is more conserved in all the organisms than the other functional domains of the protein We compared the Ca2+ -binding and Mg2+ -binding ... occurring in Calnuc upon metal ion binding Ca2+ and Mg2+ binding lead to an increase in the fluorescence intensity of the tryptophans in an ion-dependent fashion Ca2+ binding leads to a two-fold increase ... between proteins classically known to adopt the c2 domain for binding to Ca2+ and Calnuc In proteins containing c2 domains, the Ca2+ -binding sites are formed primarily by the side chains of Asp,...
  • 18
  • 333
  • 0
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

Báo cáo khoa học

... cell death [65,66] The AR contains an N-terminal domain harboring activation function 1, a central DNA -binding domain (DBD) and a C-terminal ligandbinding domain (LBD) containing activation function ... ligand -binding domain Actin -binding protein Targeting sequence Gelsolin Direct or indirect association with the AR Region LBD Classes Role in the cytoplasm AR effect Mechanism ()) Actin filament ... Direct a-actinin-2 ()) Bundling proteins Coactivator Supervillin NLS F-actin- and membraneassociated scaffolding protein Filamin NLS? Cross-linking proteins Filamin A NLS? Cross-linking proteins Transgelin...
  • 17
  • 573
  • 0
Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot

Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot

Báo cáo khoa học

... proteins nesprin 1a and nesprin [28,29] Since the different binding regions overlap at least partially, a simultaneous binding of some binding partners may be excluded, giving rise to distinct ... mislocalization of emerin that is caused by the loss of emerin binding to lamin A (X- linked form) or by the loss of lamin A (autosomal dominant form) [22,23] Several emerin binding partners have ... proteins shown to interact with emerin, binding regions were mapped onto the emerin sequence (Fig 5B) The best characterized of these interactions occurs between the DNA ⁄ protein complexes of the...
  • 12
  • 429
  • 0
Báo cáo Y học: Membrane embedded location of Na+ or H+ binding sites on the rotor ring of F1F0 ATP synthases ppt

Báo cáo Y học: Membrane embedded location of Na+ or H+ binding sites on the rotor ring of F1F0 ATP synthases ppt

Báo cáo khoa học

... reconstituted into POPC, indicating similar membrane embedded coupling ion binding sites on their enzyme (Fig 5B) The fact that the binding site of the I tartaricus enzyme is embedded in the membrane ... buried binding sites of the c11 rotor ring within a lipid bilayer without the presence of subunit a These results therefore reinforce our model for the rotor ring with 11 intrinsic channels linking ... of the binding site from the aqueous environment The modication of the binding sites by DCCD was specically protected by Na+ that conrms the direct access of Na+ to the c subunit sites by intrinsic...
  • 9
  • 439
  • 0
Báo cáo khoa học: Evaluation of potential regulatory elements identi®ed as DNase I hypersensitive sites in the CFTR gene doc

Báo cáo khoa học: Evaluation of potential regulatory elements identi®ed as DNase I hypersensitive sites in the CFTR gene doc

Báo cáo khoa học

... increasing amounts of DNase show a proportionate increase in the intensity of the DHS fragments in the control samples In Fig 7A the forskolin-treated chromatin shows a relative increase in the ... similar intensity but the DHS in intron 18 is less evident (Fig 5B) In contrast, the DHS in intron 18 is more prominent than those in introns 16 and 17 (Fig 5A) in chromatin from Capan1 cells The ... the pancreatic cell lines Capan1 and NP31 were evaluated further DHS in airway epithelial cells were investigated further in the airway carcinoma cell line Calu3 Of particular interest were the...
  • 7
  • 568
  • 0
Poisoning the Well: How the EPA is Ignoring Atrazine Contamination in Surface and Drinking Water in the Central United States pot

Poisoning the Well: How the EPA is Ignoring Atrazine Contamination in Surface and Drinking Water in the Central United States pot

Ngân hàng - Tín dụng

... Poisoning the Well: How the EPA is Ignoring Atrazine Contamination in Surface and Drinking Water in the Central United States An Atrazine Primer Atrazine is a selective herbicide ... chemicals Poisoning the Well: How the EPA is Ignoring Atrazine Contamination in Surface and Drinking Water in the Central United States Recommendations for Protecting Human Health and the Environment ... atrazine as well as the presence of atrazine in drinking water Under the Safe Drinking Water Act (SDWA), the EPA has determined that no more than parts per billion (ppb) of atrazine (as a running...
  • 4
  • 530
  • 0
Báo cáo khoa học: Functional significance of five noncanonical Ca2+-binding sites of human transglutaminase 2 characterized by site-directed mutagenesis potx

Báo cáo khoa học: Functional significance of five noncanonical Ca2+-binding sites of human transglutaminase 2 characterized by site-directed mutagenesis potx

Báo cáo khoa học

... Characters in bold italics indicate potential Ca2+ -binding sites as compared with those in TG2 The amino acids in the frames may preclude Ca2+ binding as compared with the homologous sites in other ... 7091 Ca2+ -binding sites of TG2 ´ly R Kira et al Fig Multiple sequence alignment of Ca2+ -binding sites of transglutaminases Sequence alignments of Ca2+ -binding sites of TG2 compared with the other ... a large number of Ca2+ -binding proteins, not share significant similarities with the Ca2+ -binding motifs of the transglutaminase family Interestingly, TG2 also has a GTP -binding site and can hydrolyze...
  • 14
  • 378
  • 0
Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterfly, Papilio xuthus docx

Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterfly, Papilio xuthus docx

Báo cáo khoa học

... species of the hydrophobicligand -binding protein and solely binds 3-hydroxyretinol as an intrinsic ligand, we termed this protein the Papilio retinol -binding protein (Papilio RBP) Further analysis ... ligand -binding protein in the fly chemosensory hair [26]) The calculated pI value of the Papilio RBP is 4.92; the protein is highly acidic This explains the high mobility of the protein in the native ... retinol -binding protein, Papilio RBP We identified a novel type of protein that binds retinol, which we termed the Papilio retinol binding protein (Papilio RBP) The native ligand of this protein...
  • 10
  • 596
  • 0
Báo cáo khoa học: Polysaccharide binding sites in hyaluronate lyase – crystal structures of native phage–encoded hyaluronate lyase and its complexes with ascorbic acid and lactose docx

Báo cáo khoa học: Polysaccharide binding sites in hyaluronate lyase – crystal structures of native phage–encoded hyaluronate lyase and its complexes with ascorbic acid and lactose docx

Báo cáo khoa học

... provides insight into the inhibitor binding sites in HylP2 and postulates the substrate binding regions in the bacteriophage enzyme as a result of ascorbic acid being structurally similar to the glucuronate ... polysaccharide binding site in HylP2 The conformational changes observed in the side chains of Glu167 and Lys179 upon binding to ascorbic acid are shown by superimposing their binding regions of ... Phe264 The structures of the complexes of HylP2 indicate the existence of three subsites in the long concave binding site of the enzyme where lactose and ascorbic acid are located The binding...
  • 11
  • 517
  • 0
Báo cáo khoa học: DG-based prediction and experimental confirmation of SYCRP1-binding sites on the Synechocystis genome pot

Báo cáo khoa học: DG-based prediction and experimental confirmation of SYCRP1-binding sites on the Synechocystis genome pot

Báo cáo khoa học

... observed changes in B binding free energy using the independent binding model DDGtotal values were calculated based on the independent binding model, whereby independent binding free energies ... putative binding sites Twenty-three putative binding sites were obtained (Table 1) The binding site for the slr1667–slr1668 operon, which is regulated by SYCRP1, is included among these sites 4788 In ... whether SYCRP1 binds to putative binding sites or not are shown Eleven putative binding sites selected in ascending A order of DDGtotal are shown Confirmation of SYCRP1 binding to putative binding...
  • 10
  • 245
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008