ca 2 regulation of muscular contraction
Tài liệu Báo cáo khoa học: Roles of AP-2 transcription factors in the regulation of cartilage and skeletal development doc
... Schorle H (20 05) The AP -2 family of transcription factors Genome Biol 6, 24 6, doi:10.1186/gb -20 05-6-13 -24 6 12 Moser M, Ruschoff J & Buettner R (1997) Comparative analysis of AP -2 alpha and AP -2 beta ... expression of a new AP -2 transcription factor, AP -2 epsilon Dev Dyn 23 1, 128 –135 Garcia MA, Campillos M, Ogueta S, Valdivieso F & Vazquez J (20 00) Identification of amino acid residues of transcription ... analyses of the regulation of AP -2 and the interactions of the transcription factor with binding partners, as well as of the regulation of target gene expression, have been performed for AP-2a Up...
- 9
- 642
- 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... Journal 27 3 (20 06) 5333–5346 ª 20 06 The Authors Journal compilation ª 20 06 FEBS Y Ding et al 24 25 26 27 28 29 30 31 32 33 34 35 36 Yoshida T (1995) Heme oxygenase -2 Properties of the heme complex of ... with HO -2 siRNA in HepG2 cells These results indicate that the down -regulation of HO -2 expression is associated with induction of HO-1 expression FEBS Journal 27 3 (20 06) 5333–5346 ª 20 06 The ... 5¢-UAUAAGAGUCAGUACACAUCAUGGAAG-3¢, antisense, 3¢-UAAUAUUCUCAGUCAUGUGUAGUACCU-5¢ Another HO -2- specific siRNA, HO -2 siRNA1 (target base 21 2 23 2) reported by other investigators [ 32] , was also used GAPDH...
- 14
- 487
- 0
Báo cáo Y học: Regulation of RAS in human platelets Evidence that activation of RAS is not sufficient to lead to ERK1-2 phosphorylation pot
... WB:P-Y IP:GRB2, WB:SYK 62 47 25 32 kDa kDa 32 IP:SHC, WB:GRB2 IP:GRB2, WB:P-Y IP:GRB2, WB:LAT 25 kDa 25 IP:GRB2, WB:GRB2 kDa IP:GRB2, WB:GRB2 Convulxin and TPO induce GRB2 recruitment to phosphorylated ... & Watson, S.P (20 01) Phosphatidylinositol Regulation of RAS in platelets (Eur J Biochem 26 9) 1517 25 26 27 28 29 30 31 3-kinase-dependent translocation of phospholipase Cgamma2 in mouse megakaryocytes ... to induce pleckstrin _ Ro 31 822 0 _ + _ + 25 kDa WB: P-ERK Cvx Cvx +Ro kDa Thr 25 kDa _ Ro 31 822 0 _ + _ + Pull-down: RAF-RBD 25 kDa WB: RAS Fig PKC inhibitor Ro-31 822 0 inhibited ERK but not RAS...
- 7
- 436
- 0
Báo cáo khoa học: Pituitary adenylate cyclase-activating polypeptide attenuates streptozotocin-induced apoptotic death of RIN-m5F cells through regulation of Bcl-2 family protein mRNA expression pdf
... (GenBank accession no Z2 327 9 for basic, Z2 327 3 for hip, Z2 327 4 for hop1, Z2 327 5 for hop2, and Z2 327 2 for hiphop1) were 5¢-TTTCA TCGGC ATCAT CATCA TCATC CTT-3¢ (sense) and 5¢-CCTTC CAGCT CCTCC ATTTC ... both PACAP27 and PACAP38 were unable to attenuate down -regulation of Bcl-XL mRNA, they promoted expression of Bcl -2 mRNA significantly According to these novel findings, the regulation of Bcl -2, Noxa ... Authors Journal compilation ª 20 08 FEBS M) 33.7 22 .1 7.3 12. 9 14 .2 14.9 19 .2 14 .2 ± ± ± ± ± ± ± ± 2. 4** 5.7** 4.0* 3.9** 3.0** 4.3** 5.3** 7.1* 25 .1 ± 5.0** 5545 PACAP attenuates streptozotocin-induced...
- 10
- 302
- 0
Báo cáo khoa học: Calcium-induced contraction of sarcomeres changes the regulation of mitochondrial respiration in permeabilized cardiac cells doc
... on mitoFEBS Journal 27 2 (20 05) 31453161 ê 20 05 FEBS SF, 2. 0 àM Ca2 +,+Cr 1,5 SF, 0.1 àM Ca2 + SF, 2. 0 àM Ca2 + 0,5 0 SF, 0.1 àM Ca2 +,+Cr 2, 5 20 0 400 600 800 1000 ATP, àM Fig 11 The effect of creatine ... Biol Chem 27 6, 21 4 822 1488 19 Balaban RS (20 02) Cardiac energy metabolism homeostasis: role of cytosolic calcium J Mol Cell Cardiol 34, 125 9 127 1 20 Korzeniewski B (1998) Regulation of ATP supply ... ATP 20 0 100 0,5 0 Ca2 +, àM C Ca2 +, àM D 400 3,5 300 2, 5 Km, àM VO2 max, nmolO2*mg-1(ww)*min-1 300 Km, àM VO2 max, nmolO2*mg-1(ww)*min-1 A 1,5 GF, ADP GF, ATP 20 0 GF, ADP GF, ATP 100 0,5 0 Ca2 +,...
- 17
- 241
- 0
Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx
... reported that the levels of Fru -2, 6-P2 were Ó FEBS 20 02 significantly increased by adenovirus-mediated overexpression of a mutant form of 6-phosphofructo -2- kinase/ fructose -2, 6-bisphosphatase in ... Physiol 26 6, E796–E803 Roden, M., Perseghin, G., Petersen, K.F., Hwang, J.H., Cline, G.W., Gerow, K., Rothman, D.L & Shulman, G.I (1996) The 4 426 I.-Y Choi et al (Eur J Biochem 26 9) 21 22 23 24 25 26 ... than its inhibition of fructose-1,6bisphosphatase This is a significant observation because it offers the first in vivo assessment of the action of Fru -2, 6-P2 on the 6-phosphofructo-1-kinase/fructose-1,6-bisphosphatase...
- 9
- 465
- 0
Báo cáo khoa học: Regulation of the human leukocyte-derived arginine aminopeptidase/endoplasmic reticulum-aminopeptidase 2 gene by interferon-c pot
... receptors requires a FEBS Journal 27 2 (20 05) 916– 928 ª 20 05 FEBS 24 25 26 27 28 29 30 31 32 33 34 35 36 37 multifunctional aminopeptidase, aminopeptidase regulator of TNF receptor type shedding J ... S410–S 420 12 Keller SR, Scott HM, Mastick CC, Aebersold R & Lienhard GE (1995) Cloning and characterization of a FEBS Journal 27 2 (20 05) 916– 928 ª 20 05 FEBS Regulation of L-RAP ⁄ ERAP2 gene expression ... promoter activity in HEK293 (data not shown) We found by RT-PCR FEBS Journal 27 2 (20 05) 916– 928 ª 20 05 FEBS T Tanioka et al Regulation of L-RAP ⁄ ERAP2 gene expression Fig Role of the IRF-E and Ets...
- 13
- 238
- 0
Báo cáo khoa học: Chick embryo anchored alkaline phosphatase and mineralization process in vitro Influence of Ca 2+ and nature of substrates doc
... centrifuged Ca2 + and Pi were determined in the pellets corresponding to the mineral structure Symbols corresponding to various Ca2 + concentrations are: n, Ca2 + 2. 5 mM; e, Ca2 + mM; h, Ca2 + 7.5 mM; s, Ca2 + ... the Ca2 + concentration increased from 2. 5 mM to 6–7.5 mM, the mineralization began at 48 h At 144 h the Ca/ Pi ratio was % 1 .2 1.3 At 24 mM Ca2 +, HA crystals were obtained at about 12 h with a Ca/ Pi ... Wavenumber (cm)1) 1 125 –1145 918– 924 10 52 1060 587–600 1038 1 127 741 561–563 575 601–603 960 10 32 10 92 1094 11 12 1116 Origin HPO 42 HPO 42 Ref stretch stretch m3 m4 m3 PO3 stretch in HPO 42 OH libration...
- 9
- 367
- 0
báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pptx
... matrix mineralization Exp Cell Res 20 00, 25 7 :21 3 -22 2 28 Chen D, Zhao M, Mundy GR: Bone morphogenetic proteins Growth Factors 20 04, 22 :23 3 -24 1 29 Mundy GR: Regulation of bone formation by bone morphogenetic ... BMP -2 Average SD Average SD Average SD p-value Collagen Type I 85,081.73 2, 5316.39 **678 .21 358 .27 *170 ,24 3.43 24 ,493.77 0.0003 Fibronectin 55, 827 .93 1 ,21 19.18 *28 ,4 32. 19 1195. 92 * *23 9,750.67 23 ,464.19 ... 39.8 ± 7 .2 BMP -2 41.5 ± 5.6 PGE2 84.1 ± 23 .1 Representative experiment showing the effects of IGF-1 (20 ng/ml), FGF -2 (2. 0 ng/ml), TGFb (2 ng/ml), PDGF (3 ng/ml), BMP -2 (100 ng), PGE2 (2 μg/ml)...
- 8
- 547
- 0
báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pdf
... matrix mineralization Exp Cell Res 20 00, 25 7 :21 3 -22 2 28 Chen D, Zhao M, Mundy GR: Bone morphogenetic proteins Growth Factors 20 04, 22 :23 3 -24 1 29 Mundy GR: Regulation of bone formation by bone morphogenetic ... BMP -2 Average SD Average SD Average SD p-value Collagen Type I 85,081.73 2, 5316.39 **678 .21 358 .27 *170 ,24 3.43 24 ,493.77 0.0003 Fibronectin 55, 827 .93 1 ,21 19.18 *28 ,4 32. 19 1195. 92 * *23 9,750.67 23 ,464.19 ... 39.8 ± 7 .2 BMP -2 41.5 ± 5.6 PGE2 84.1 ± 23 .1 Representative experiment showing the effects of IGF-1 (20 ng/ml), FGF -2 (2. 0 ng/ml), TGFb (2 ng/ml), PDGF (3 ng/ml), BMP -2 (100 ng), PGE2 (2 μg/ml)...
- 8
- 460
- 0
Ceftriaxone-induced up-regulation of cortical and striatal GLT1 in the R6/2 model of Huntington’s disease pps
... R6/2s WTc R6/2c 9-week 27 .53 ± 1.18 (N = 4) 26 . 52 ± 1. 02 (N = 4) 27 .27 ± 1. 02 (N = 4) 28 .06 ± 1.18 (N = 4) 13-week 34.3 ± 2. 75 (N = 5) *26 .78 ± 1.69 (N = 5) 33.00 ± 0.98 (N = 5) *24 . 52 ± 2. 33 ... 37(7):1518-1 524 doi:10.1186/1 423 -0 127 -17- 62 Cite this article as: Sari et al.: Ceftriaxone-induced up -regulation of cortical and striatal GLT1 in the R6 /2 model of Huntington’s disease Journal of Biomedical ... Received: 24 May 20 10 Accepted: 27 July 20 10 Published: 27 July 20 10 References DiFiglia M: Excitotoxic injury of the neostriatum: a model for Huntington’s disease Trends Neurosci 1990, 13(7) :28 6 -28 9...
- 5
- 380
- 0
Báo cáo y học: "A poxvirus Bcl-2-like gene family involved in regulation of host immune response: sequence similarity and evolutionary history" pptx
... Acids Res 20 00, 28 :23 5 -24 2 22 Ginalski K, Elofsson A, Fischer D, Rychlewski L: 3D-Jury: a simple approach to improve protein structure predictions Bioinformatics 20 03, 19:1015-1018 23 Proteinkeys ... analysis of a complete Page 12 of 12 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 poxvirus transcriptome reveals an immediate-early class of genes Proc Natl Acad Sci USA 20 08, 105 :21 40 -21 45 ... usually located in poxvirus genomes [25 ,26 ] Eight of the orthologue groups can be found in orthopoxvirus genomes: N1L, N2L, A52R and B15R can González and Esteban Virology Journal 20 10, 7:59...
- 12
- 306
- 0
Báo cáo y học: " Cysteinyl-leukotrienes in the regulation of β2-adrenoceptor function: an in vitro model of asthma" ppsx
... leukocyte adhesion in postcapillary venules: in vivo effects 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 with relevance to the acute inflammatory response Proc Natl Acad Sci USA 1981, ... aerated (95% O2, % CO2) PSS of the following composition (mM): NaCl 110.5, KC1 3.4, CaCl2 2. 4, MgSO4 0.8, KH2PO4 1 .2, NaHCO3 25 .7, and dextrose 5.6, as previously described in details [26 ] The serum ... Ca2 +-independent Am J Respir Crit Care Med 20 01, 163(1) :26 6 -27 2 Song P, Milanese M, Crimi E, Rehder K, Brusasco V: Allergen challenge of passively sensitized human bronchi alters M2 and beta2...
- 11
- 243
- 0
NOVEL MECHANISMS IN THE REGULATION OF PERINUCLEAR ACTIN ASSEMBLY 2
... Results 81! 4 .2. 1! Accumulation of mDia2 to nuclear envelope (NE) 81! 4 .2. 2! mDia2 is localized to the cytoplasmic side of NE 84! 4 .2. 3! Co-localization of mDia2 with NPC and importin ... overexpression of mDia2 have been reported to induce human deafness (Lynch et al., 1997; Schoen et al., 20 13) 1 .2. 3 .2 INF2 INF2 has two C-terminal splice variants: the CAAX variant (prenylated, 22 isoform ... 51! 3 .2! Results 52! 3 .2. 1! Force activation induces reversible perinuclear actin polymerization ……………………………………………………………………. 52! 3 .2. 2! The role of calcium 57! 3 .2. 3! The...
- 141
- 266
- 0
The regulation of nuclear factor erythroid derived 2 related factor 2 (NRF2) in the phase 2 response 2
... Immunoblotting 20 2. 6 Luciferase reporter assay 20 2. 7 Immunoprecipitation 21 2. 8 Immunoflourescence 21 2. 9 Collection and processing of plants 22 2. 10 Growth and isolation of endophytes 22 2. 11 Molecular ... al., 20 06 12 Ub Ub Ub Nrf2 ET GE KEL CH DLG Ub KELCH C288 IVR C288 C273 IVR C273 BTB C151 BTB C151 E2 E2 E2 Keap1 Ub Rbx1 Cullin3 Figure 1 .2 Schematic representation of the binding of Keap1 ... Mouse Models 1.5 Regulation of Nrf2 activity 1.5.1 Post-translational modification of Nrf2 1.5 .2 Degradation of Nrf2 : Keap1 and Cullin3 E3 Ubiquitin Ligase 1.5.3 Accumulation of Nrf2 : Keap1 as...
- 119
- 332
- 0
Homoeostatic regulation of cytokines to retard liver fibrosis 2
... ACCCACACTGTGCCCATCTA 3’ 5’ GCCACAGGATTCCATACCCA 3’ 5’ AAGGTGTGCAACCGCGCTGA 3’ 5’ TTGGGGCGAGCACAGCCAAG 3’ 5’ TCGGACAAGAGAGTGCCA 3’ 5’ TCACAATCCCGCTCAGAG 3’ 5’ TGGTGAACGCCCTCTATTTC 3’ 5’ GAGGGGCACATCTTTTTCAA ... TGCTTCAGCTCCACAGAGAA 3’ 5’ TGGTTGTAGAGGGCAAGGAC 3’ 5' TGC CAT GTA TGT GGC TAT TCA 3' 5' ACC AGT TGT ACG TCC AGA AGC 3' 5’ CAAGAATGGCGACCGTGGTGA 5’ GATGGCTGCACGAGTCACACC 3’ 3’ 2. 2.7 Statistical ... GAGGGGCACATCTTTTTCAA 3’ 5’ TGCACTGAGTGTCACTGTCAGAA 3’ 5’ CATTGGAGCAGGGCATGAT 3’ 41 TIMP -2 Sense Antisense TGF-β1 Sense Antisense α-SMA Sense Antisense Collagen 1a1 Sense Antisense 5' GTTTTGCAATGCAGATGTAG...
- 26
- 187
- 0
Superoxide anion is implicated in the regulation of PP2A b56 mediated dephosphorylation of bcl 2
... catalytic subunit of PP2A 82 2.4 Co-localization of PP2A-C and Bcl -2 was inhibited in cells with an augmented O2- level 85 v 2. 5 Mitochondrial translocation of PP2A-C was inhibited ... 2A PP2A-A A scaffolding subunit of PP2A PP2AB56α B56α-containing PP2A enzyme PP2AB56γ1 B56γ1-containing PP2A holoenzyme PP2AB56δ B56δ-containing PP2A PP2A-C Catalytic subunit of PP2A pRb Retinoblastoma ... pillared by a large arsenal of antioxidant machineries capable of eradicating H2O2 2. 2 Catalase Catalase is a haem-protein responsible for the neutralization of intracellular H2O2 [87, 88] It is widely...
- 230
- 272
- 0
THE MECHANISM OF PPARN3 MEDIATED DOWN REGULATION OF SODIUM HYDROGEN EXCHANGER 1 (NHE1) GENE EPXRESSION AND ITS INHIBITION BY ESTROGEN RECEPTOR n1 2
... CCATGGAATACCAGATAGTCCTAACAAACCACTGGAAGGTAGGAGAAAGGCATGGGACAGATTC -0640 TCCCTCATAGCTCTCAGCTGAAACCAACCCTGCCAACACCTAGATCCGACCTCCAGCCTCCAGA -0576 ACTGTGAGACAATCAATTTCTGTTGTTGCAGCCACCCAGTTTGGGGTGATACTTTGTTACGGCA -05 12 ... ATCCCAGCTACTCTGGAGGCTGAGGCAGGAGAATCGCTTGAATCCAGGAGGCAGAGGTTGCATT -08 32 GAGCTGAGATGGCGCCACCGCACTCCAGCCTGGGCAACAAGAGCCAGACTCTATCTCAAAAAAA -0768 ATAAAAATAAAAATAAAGTGTGGGCGGGGAATCTGGACGCAGAGACAGAGACACCAGGAGAACT -0704 CCATGGAATACCAGATAGTCCTAACAAACCACTGGAAGGTAGGAGAAAGGCATGGGACAGATTC ... GCCCTAGTAAGCAATACAACTACTTGCATAGTAGCCAGGGGACTCTCTTCACCTGTTTCCTCAT -0448 CTGTAAAAGTGGAATTGTAATAATGTGCCAGGGTGCATTCCAAATAGTTTACACGGATTGTCTC -0384 AGTCATTACATCATCCCTCTGACATAGTCACTATTACTGTCTCTACTTAACAGATGAGAAAGTT...
- 42
- 295
- 0
Investigations on the roles of ubiquitin in the regulation of heat shock gene HSP70B 2
... Vectors 60 2. 1.5 Transformation and Inoculation 60 2. 1.6 Low-yield Purification of Plasmid DNA (Miniprep) 61 2. 1.7 Qualification of Miniprep product 62 2.1.8 DNA Sequencing 62 2 .2 Synthesis of Constructs ... Interference of hSKP1 and hSRB7/MED21 63 2. 2.1 Design of siRNA pSuper Constructs 63 2. 2 .2 Annealing of Constructs 63 2. 3 Transfection of High Quality Plasmids into HeLa Cells 64 iv 2. 3.1 Retransformation ... Beads 120 Figure 19: Immunoprecipitation of hCul1 122 Figure 20 : Immunoprecipitation of hMed6 123 Figure 21 : Co-immunoprecipitation of Cul1 by Med6 with Protein A and Protein G 124 Figure 22 : Co-immunoprecipitation...
- 16
- 266
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25