c transmission and distribution

Text book of electrical technology

Text book of electrical technology

Ngày tải lên : 26/11/2014, 11:10
... Underground Cables—Insulation Resistance of a Single-core Cable—Capacitance and Dielectric Stress— Capacitance of 3-core Belted Cables—Tests for Three-phase Cable Capacitance—A .C Distribution Calculations—Load ... Furnaces—Direct Arc Furnace—Indirect Arc Furnace — Induction Heating—Core-type Induction Furnace— Vertical Core-Type Induction Furnace—Indirect Core-Type Induction Furnace—Coreless Induction Furnace—High ... (Flywheel Accelerating) — Choice of Flywheel — Objective Tests 46 Electronic Control of AC Motors Classes of Electronic AC Drives — Variable-Frequency Speed Control of a SCIM—Variable Voltage Speed Control...
  • 454
  • 849
  • 1
RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE OF A COMPLETE MINIMAL SURFACE

RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE OF A COMPLETE MINIMAL SURFACE

Ngày tải lên : 14/10/2015, 07:57
... · · · + cjk ωk = with Set k i=0 |cji |2 = G(Hj ) = Gz (Hj ) := cj0 g0 + · · · + cjk gk We will now, for each contact function φp (Hj )of g for each a hyperplane Hj , choose one of the components ... divergent curve Γ0 in M, contradicting the assumption of completeness of M Thus, we conclude that A1 is complete Step 6: Since the metric on A1 is flat outside of a compact set K, by a theorem ... a local holomorphic coordinate Set φi := √ ∂xi /∂z (i = 1, 2, 3) and φ := φ1 − −1φ2 Then, the (classical) Gauss map g : M → P1 (C) is given by g= φ3 √ , φ1 − −1φ2 and the metric on M induced...
  • 24
  • 372
  • 0
Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx

Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx

Ngày tải lên : 12/08/2014, 12:20
... 5'-CTG CTC ATA GCA GCC ACC TT-3', reverse 5'-TCC TGA ACC CAC TTC TGC TT-3'; CX3CR1, forward 5'-GAC TGG CAG ATC CAG AGG TT-3', reverse 5'-ACC AAC AAA TTT CCC ACC AG-3'; CX3CL1, forward 5'-GGC TCC ... CTT CAC ACT TG-3'; CD16 forward 5'-ACA GGT GCC AGA CAA ACC TC-3', reverse 5'-TTC CAG CTG TGA CAC CTC AG-3'; CD32 forward 5'-TTC AAG GCC AAC AAC AAT GA-3', reverse 5'-GGA GAA GGT GGG ATC CAA AT-3'; ... AT-3'; CD64 forward 5'-GTG TCA TGC GTG GAA GGA TA-3', reverse 5'-GCA CTG GAG CTG GAA ATA GC-3'; CCR2 forward 5'-ATC TCC GCC TTC ACT TTC TG-3', reverse 5'-AAT GCG TCC TTG TTC AAT CC-3'; CCL2 forward...
  • 12
  • 200
  • 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Ngày tải lên : 21/02/2014, 03:20
... 5¢-GAGCCCGGATCCACCATGAA GGTCTCAATAATT 3¢; 3¢ primer, 5¢-CTGACG GAAT TCTTAAACATTAATGCC 3¢ These primers encoded a Kozak consensus sequence as well as BamHI and EcoRI restriction sites The PCR-amplified ... [IC50]/(1 + [L]/Kd) with [L] for the free probe concentration and Kd the measured dissociation constant of ASP 3c- ASA complex Ligand d IC50 (lM) Kdiss (lM) C1 4-Ac BrC15-Ac C1 6-Ac C1 8-Ac C1 6-Me C1 8-Me ... quenching-based ligand binding We tested tryptophan intrinsic fluorescence quenching using brominated fatty acid 15-bromopentadecanoic acid (BrC15-Ac) (Fluka, France) and palmitic acid (C1 6-Ac)...
  • 11
  • 642
  • 0
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

Ngày tải lên : 22/02/2014, 02:20
... participants agree with each other In order to establish this, we calculate an average Spearman’s correlation coefficient (non-parametric Pearson’s correlation coefficient) between each participant ... Alternative Zun¨ chst blieb die Brandursache unbekannt a Die Brandursache blieb zun¨ chst unbekannt a Unbekannt blieb die Brandursache zun¨ chst a Unbekannt blieb zun¨ chst die Brandursache a Freq ... Hence this exact match upper bound An upper bound in terms of BLEU score cannot be computed because BLEU score is computed on entire corpora rather than individual sentences Experiments 3a and...
  • 9
  • 479
  • 0
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

Ngày tải lên : 22/02/2014, 04:20
... 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ ... 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ 5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢ 5¢-GTAAAACGACGGCCAGT-3¢ Ó FEBS 2002 4-Coumarate:CoA ligase gene family from Glycine ... 4CL13-EcoRI 4CL14-BamHI 4CL14-GSP1 4CL14-GSP2 4CL16-GSP1 4CL16-GSP2 4CL16-SphI Seq1 5¢-GTTGCGTAGGACGAGCAT-3¢ 5¢-CGGATGCCGATTTTGTGGAGG-3¢ 5¢-GCTGGTACCGCACCTTCTCCACAAG-3¢ 5¢-TCYGGRTCRTTNAGRTADCCTTTCAT-3¢...
  • 12
  • 448
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Ngày tải lên : 07/03/2014, 16:20
... CLAP_1:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC CLAP_2:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC ... 188 CLAP_1:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAGAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT CLAP_2:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAAAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT ... 121 CLAP_1:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT CLAP_2:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT...
  • 12
  • 772
  • 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Ngày tải lên : 08/03/2014, 08:20
... hydroxybenzoic acids: 4-hydroxybenzoic acid (I) and 3,4,5-trihydroxybenzoic acid (gallic acid) (II), or the hydroxycinnamic acids: 4-hydroxycinnamic acid (p-coumaric acid) (III) and 3,4-dihydroxycinnamic ... BellCo, USA) containing Murashige and Skoog macro- and micro-elements, iron chelates and vitamins [12], plus 50 mgÆL)1 ascorbic acid, 30 gÆL)1 sucrose, lmolÆL)1 2,4-dichlorophenoxyacetic acid, ... (II), p-coumaric acid (4-hydroxycinnamic acid) (III) and caffeic acid (3,4-dihydroxycinnamic acid) (IV) were purchased from Merck, (Fig 1) Kaempferol (3,4¢,5,7-tetrahydroxyflavone) (V), quercetin...
  • 10
  • 624
  • 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Ngày tải lên : 16/03/2014, 14:20
... PCR amplified from chromosomal DNA of P furiosus using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing ... tetrameric structure and contain one or two zinc atoms per subunit, a catalytic and ⁄ or structural zinc atom Size-exclusion chromatography indicated a homotetrameric structure for Pf-TDH, and metal ... decarboxylates to aminoacetone and CO2, or is cleaved in a CoA-dependent reaction by 2-amino-3-ketobutyrate coenzyme A lyase to glycine and acetyl-CoA Aminoacetone can be further converted into 1-aminopropan2-ol,...
  • 8
  • 415
  • 0
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Ngày tải lên : 17/03/2014, 09:20
... MMOB appear to be critical in the catalytic cycle Acknowledgements This work was funded by the Biotechnology and Biological Sciences Research Council (BBSRC) and British Gas PLC through a Hub studentship ... current increased None Catalytic current increased Catalytic current increased; oxygenated product observedb + substrate No product observed in the presence of catalase Reaction(s) inferreda O2 ... the lack of catalytic current in the absence of catalase, presumably because the hydrogen peroxide inactivated MMOH Addition of MMOB to the MMOH-activated electrode produced an increase in current...
  • 6
  • 464
  • 0
Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx

Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx

Ngày tải lên : 22/03/2014, 11:20
... 0.976dB 9.626dB (a) (b) Fig (a) The frequency characteristics; (b) Spectrum at 1030MHz Conclusion We have designed, successfully fabricated and tested the power combination unit using the Wilkinson ... loss and discontinuity effects, IEEE Trans MTT-27, Mar (1979) 239 [3] R Mehran, A method of analysis and design of microstrip directional couplers considering dispersion and discontinuity effects, ... Duong, Research, Design And Fabrication Of The 45W And The 200W, L-Band Power Amplifier Using The Modern Microstrip Technology For Application In The National Sovereignty Identification Coding System,...
  • 5
  • 374
  • 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Ngày tải lên : 23/03/2014, 04:21
... 5¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢ The forward primer incorporated an NdeI site and the reverse primer incorporated ... 5¢-ACTTATACTACTCATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATCCTCG AGATAAAAATCCATCACCCG-3¢, and digested this with restriction enzymes NdeI and XhoI for subcloning into pET23a and ... and E deriving from the XhoI restriction site Likewise, we also amplified the cDNA for bB2 using forward primer 5¢-ACTTATACTACTCATATGCTCAACCC CAAGATCATC-3¢ and reverse primer 5¢-ACTTATAC TATCCTCGAGCCACTGCATGTCCCGG-3¢,...
  • 13
  • 430
  • 0
Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt

Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt

Ngày tải lên : 23/03/2014, 10:21
... several characteristic regions could be identied, including 14 Cys residues and the consensus sequences CTR(K)SxPPTC and CxY(L R)SxPxQ(K )C for the antitrypsin and antichymotrypsin sites, respectively ... macromolecular energy minimisation, and dynamics calculation J Comput Chem 4, 187217 Schneider TR, Brunger AT & Nilges M (1999) Inuence of internal dynamics on accuracy of protein NMR structures: ... were checked by UV absorbance at 280 nm using a molar extinction coefcient value calculated on the basis of the amino acid sequence (e ẳ 4680 m)1ặcm)1) In the antitrypsin and antichymotrypsin activity...
  • 16
  • 518
  • 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

Ngày tải lên : 23/03/2014, 13:20
... protein-saccharide complexes In Water and Biological Macromolecules (Topics in Molecular and Structural Biology) (Westhof, E., ed.), pp 321–337 CRC Press, Boca Raton 15 Baratova, L.A., Grebenshchikov, ... S (1993) Polysaccharide interactions with water In Water and Biological Macromolecules (Topics in Molecular and Structural Biology) (Westhof, E., ed.), pp 295–320 CRC Press, Boca Raton 21 Laemmli, ... The role of CP glycosylation in plant virus life cycles remains unclear, although data on the effects of glycosylation on the conformation and dynamics of O-linked glycoproteins are accumulating...
  • 10
  • 398
  • 0
Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc

Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc

Ngày tải lên : 23/03/2014, 17:20
... metric clearly correlates most closely with the human judgements, and it is the only metric that has a statistically significant correlation BLEU and TER correlate particularly poorly, with correlation ... the strings chosen by the log-linear and language models The standard evaluation procedure relies on both strings being identical to calculate (un-)labelled dependency accuracy, and so we map ... strings We calculate both a weighted and unweighted dependency fscore, as given in Table The unweighted f-score is calculated by taking the average of the scores for each dependency type, while...
  • 4
  • 285
  • 0
Báo cáo khoa học: A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis docx

Báo cáo khoa học: A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis docx

Ngày tải lên : 29/03/2014, 09:20
... accession no.: AAC61735), HsSpo11 from Homo sapiens (accession no.: AAD52562), ScSpo11 from Saccharomyces cerevisiae, SpSpo11 from Schizosaccharomyces pombe (rec12; accession no.: CAB11511) and ... to exclude possible non-speci c negative effects caused by the replacement of a basic amino acid residue with an acidic amino acid residue, we constructed a series of coding DNAs in which the ... PCR amplifidsDNA, using the primers 180L and Closed-circular pUC18 dsDNA and were purchased from TAKARA Bio Inc Detailed procedure to construct vectors for expression of soluble SPO11-1 in E coli...
  • 15
  • 393
  • 0
Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc

Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc

Ngày tải lên : 31/03/2014, 08:20
... time peak was collected and rerun on the same column to purify the peptide further For ikitoxin, fraction P3 of the C4 column was collected and injected into the same microbore C1 8 column running ... MO, USA) to reduce electrode capacitance The tip of each electrode was filled with Ôpipette solutionÕ that contained 15 mM NaCl, 140 mM CsOH, 2.6 mM MgCl2, 0.34 mM CaCl2, mM EGTA and 10 mM Hepes ... (http://www.expasy.ch) was used to visualize and compare the effect of the substitution of a glutamic acid for a glycine on the structure and electrochemical surface of birtoxin The mutation was introduced...
  • 8
  • 425
  • 0
improving near field confinement of a bowtie aperture using surface plasmon polaritons

improving near field confinement of a bowtie aperture using surface plasmon polaritons

Ngày tải lên : 06/05/2014, 08:53
... periodicity Figures 2͑a͒ and 2͑b͒ compare the electric field distribution of the slit ͑only͒ and the slit with grooves Clearly, the grooves create a directional field beaming in the propagating direction ... 0.25 FIG ͑Color online͒ Comparison of electric field distributions of ͓͑a͒– c ͔ single bowtie aperture and ͓͑d͒–͑f͔͒ bowtie aperture with circular grooves at working distances of 20, 50, and 100 ... near-field confinement is different from diffraction in far-field collimation For farfield collimation, the relative phase difference of waves produced by each groove is 2␲ to achieve constructive interference...
  • 3
  • 347
  • 0
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx

Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx

Ngày tải lên : 20/06/2014, 20:20
... transmitted and reflected electrons The transmission feature shown above can be examined by the measurable quantities, the conductance G, and Fano factor F [20, 21] The ballistic conductance and Fano factor ... electric and magnetic potential barrier on the surface of a 3D topological insulator, as shown in Figure We can create magnetic and electric potentials underneath a superconducting plate and ... China CAE Team, Semiconductor R&D Center, Samsung Electronics Co., Ltd., Gyeonggi-Do, Korea Department of Physics, Semiconductor Photonics Research Center, Xiamen University, Xiamen 361005, China...
  • 18
  • 404
  • 0
Báo cáo hóa học: " Research Article Convergence Analysis of a Mixed Controlled l2 − l p Adaptive Algorithm" potx

Báo cáo hóa học: " Research Article Convergence Analysis of a Mixed Controlled l2 − l p Adaptive Algorithm" potx

Ngày tải lên : 21/06/2014, 08:20
... Zerguine, C F N Cowan, and M Bettayeb, “LMS-LMF adaptive scheme for echo cancellation,” Electronics Letters, vol 32, no 19, pp 1776–1778, 1996 A Zerguine, C F N Cowan, and M Bettayeb, “Adaptive echo cancellation ... neural network structures and performance comparison with standard architecture,” IEE Proceedings, Part I: Communications, Speech and Vision, vol 137, no 4, pp 221– 225, 1990 R Price, “A useful theorem ... Cost Function The cost function J (c) = αE[en ] + (1 − α)E[|en | p ] is a convex function defined T Case Let the input autocorrelation matrix be R = E[xn xn ], and the cross-correlation vector that...
  • 10
  • 426
  • 0