c programming questions for interview pdf

Tài liệu C Programming for Embedded Systems docx

Tài liệu C Programming for Embedded Systems docx

Ngày tải lên : 22/12/2013, 02:17
... to C necessary for targeting an embedded environment, and the common components of a successful development project. C is the language of choice for programming larger microcontrollers (MCU), ... instructions to the COPCR register. Interestingly, the COP watchdog is dependent upon the system clock; a clock monitor circuit resets the MCU if the clock stops, and thereby renders the COP watchdog ... manoeuvre. Programming the prescalar and starting the clock are tasks of the software developer. Knowing the processor clock frequency, and choosing correct prescalar values, you can achieve accurate...
  • 191
  • 549
  • 1
Tài liệu Real-Time Digital Signal Processing - Appendix C: Introduction of C Programming for DSP Applications ppt

Tài liệu Real-Time Digital Signal Processing - Appendix C: Introduction of C Programming for DSP Applications ppt

Ngày tải lên : 25/01/2014, 19:20
... %f indicates the number is floating-point data. In addition, the formatted I/O functions also recognize %d for decimal integers, %x for hexadecimals, %c for characters, and %s for character strings. The ... PROGRAMMING FOR DSP APPLICATIONS Appendix C Introduction of C Programming for DSP Applications C has become the language of choice for many DSP software developments not only because of its powerful commands ... example. C compiler translates high-level C programs into machine language that can be executed by computers or DSP proces- sors such as the TMS32 0C5 5x. The fact that C compilers are available for...
  • 18
  • 505
  • 0
Tài liệu Practical C Programming Third Edition pdf

Tài liệu Practical C Programming Third Edition pdf

Ngày tải lên : 14/02/2014, 20:20
... low-cost MS-DOS C+ + compiler called Turbo C+ +. This compiler will compile both C and C+ + code. We will describe only how to compile C code. Turbo C+ + is ideal for learning. The command line for ... generic cc compiler or the Free Software Foundation’s gcc compiler. For MS-DOS/Windows users, instructions are included for Borland C+ +, Turbo C+ +, and Microsoft Visual C+ +. (These compilers compile ... The commands for the most popular compilers are listed below. UNIX cc compiler (generic UNIX) Most UNIX-based compilers follow the same generic standard. The C compiler is named cc, and to compile...
  • 456
  • 3K
  • 7
Tài liệu Beej''''s Guide to C Programming pdf

Tài liệu Beej''''s Guide to C Programming pdf

Ngày tải lên : 16/02/2014, 08:20
... work is licensed under the Creative Commons Attribution- Noncommercial- No Derivative Works 3.0 License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-nd/3.0/ ... this is executed once, because the continuation condition is // not checked until after the body of the loop runs: do { ii Contents 1. Foreward 1 1.1. Audience 1 1.2. Platform and Compiler 1 1.3. ... after, you can use calloc() to do that in one call. I wish this section on calloc() were more exciting, with plot, passion, and violence, like any good Hollywood picture, but this is C programming...
  • 136
  • 2.2K
  • 1
PERIPHERAL BLOOD BASED C-PCR ASSAY FOR DIAGNOSING EXTRA-PULMONARY TUBERCULOSIS pdf

PERIPHERAL BLOOD BASED C-PCR ASSAY FOR DIAGNOSING EXTRA-PULMONARY TUBERCULOSIS pdf

Ngày tải lên : 06/03/2014, 04:20
... was: Forward primer (FW) 5- TCCGCTGCCAGTCGTCTTCC-3 and Reverse primer (RW) 5- GTCCTCGCGAGTCTAGGCCA – 3. Amplification reaction was performed in 25 l of master cocktail containing ... quantification of mycobacterial Fig. 6—Representative agarose gel electrophoresis picture(s) of C- PCR amplified products for the calculation of mycobacterial load from peripheral blood specimens ... used specimen for revealing the presence of tubercle bacilli in TB. However, its clinical significance in EPTB is very discouraging 3 . The diagnosis in such cases posses great challenge...
  • 7
  • 308
  • 0
Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf

Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf

Ngày tải lên : 16/03/2014, 18:20
... the concentration of sEPCR, an anti-EPCR monoclonal antibody (RCR-2) was covalen- tly immobilized on a carboxymethylated dextran (CM5) sensor chip (BIAcore) using amine coupling chemistry, according ... procedures). A nonreactive mAb was used as a control for nonspeci c binding in the reference flow cell. Increasing concentrations of wild-type sEPCR (13–106 n M) were injected across both flow cells. ... bind anionic phospholipid surfaces [16,26,27] and is there- fore crucial for its activity. The crystal structures of recombinant sEPCR, and sEPCR in complex with the Gla domain of protein C, have recently...
  • 12
  • 409
  • 0
Robert l  wood   c programming for scientists and engineers

Robert l wood c programming for scientists and engineers

Ngày tải lên : 19/03/2014, 14:13
... 2 C programming for scientists and engineers as C ++, for engineering and scientific calculations because the resulting programs can make more efficient use of the ... Introduction Executable statements are those that either process information in some way, for example performing calculations, or use information to control and co-ordinate such processing. ... structures and to access their members indirectly. Chapter review This chapter has concentrated on the different types of data that can be processed in C programs. C specifies a small ...
  • 151
  • 1.3K
  • 1
C Programming for Embedded Systems ppt

C Programming for Embedded Systems ppt

Ngày tải lên : 22/03/2014, 09:20
... ensures that application source code can be recompiled for different microcontroller targets. Page 11 (c) Wait for keystroke (1) If key is pressed, wait for debounce period and check again. (d) ... 3.2 shows the COP8 vector table, as required for the COP8SAA7 device. The rank is as enforced by the VIS instruction. Table 3.2 COP8 vectored interrupts Rank Source Description Vector Address ... recorded in main (or data) memory: the Microchip PIC and Scenix SX architectures use a stack space outside of user RAM. It is important to check the depth of return information stored by function...
  • 191
  • 390
  • 1
Interferon-c Release Assays for Active Pulmonary Tuberculosis Diagnosis in Adults in Low- and Middle-Income Countries: Systematic Review and Meta-analysis pdf

Interferon-c Release Assays for Active Pulmonary Tuberculosis Diagnosis in Adults in Low- and Middle-Income Countries: Systematic Review and Meta-analysis pdf

Ngày tải lên : 22/03/2014, 18:20
... with suspected active pulmonary tuberculosis or patients with confirmed cases in low- and middle-income countries. We summarized test performance characteristics with use of forest plots, hierarchical ... of relevant criteria from the Quality Assessment of Diagnostic Accuracy Studies (QUADAS) tool, a validated tool for diagnostic accuracy studies [23]. Because of growing concerns about con- flicts of ... 15:188–200. 13. Denkinger CM, Dheda K, Pai M. Guidelines on interferon -c release assays for tuberculosis infection: concordance, discordance or confu- sion? Clin Microbiol Infect 2011; 6:806–14. 14....
  • 10
  • 563
  • 0
C programming for microcontrollers AVR

C programming for microcontrollers AVR

Ngày tải lên : 26/03/2014, 00:02
... to lessen for all the C source files in a pro Cylon Robot, we might wan mponents we need: t to co CylonEye CylonLegs .c CylonArms .c CylonBlaster .c C and so forth… er file CylonKillerRobot.h, ... out t Most microcontr iso never change. Bu with a microcontroller. The Butterfly uses a joystick and an LCD for its built-in applications. For anything more complex, like c microcontroller software, ... Flow Control. (Refer to m section of Chapter 2 for the required acy from even before stuff for , get Jan elson’s Serial Port Complete ( www.lvr.com Projects here? Communicating with a PC...
  • 300
  • 658
  • 2
C#: Your visual blueprint for building pdf

C#: Your visual blueprint for building pdf

Ngày tải lên : 28/03/2014, 20:20
... criteria check boxes. When you click the Search in titles only check box, you can search for your keyword only in topic titles. When you click the Match related words check box, you can display topic ... BASE CLASS Java super C+ + __super C# base DERIVE A CLASS FROM A BASE CLASS Java class A extends B C+ + class A public B C# class A B SPECIFY THAT A CLASS CAN BE INHERITED Java abstract C+ + abstract C# ... looking for. For example, if you search for topics with words related to C# , you will see topics that also relate to C+ +. When you click the Search in previous results check box, you can search for...
  • 319
  • 766
  • 0
Secure Programming Cookbook for C and C++: Recipes for Cryptography, Authentication, Input Validation & More pot

Secure Programming Cookbook for C and C++: Recipes for Cryptography, Authentication, Input Validation & More pot

Ngày tải lên : 30/03/2014, 03:20
... and group for which access is to be checked. With the process’s privileges lowered, perform the access check, then restore privi- leges to what they were before the check. See Recipe 1.3 for additional ... be careful to avoid the types of race conditions known as Time of Check, Time of Use (TOCTOU), which are illus- trated in Figures 2-1 and 2-2. These race conditions occur when access is checked before ... from access( ) indicates that access will be granted. The problem is that between the time the access check via access( ) completes and the time open( ) begins (both system calls are atomic within...
  • 792
  • 4.7K
  • 3