c programming questions asked in interview pdf
Tài liệu Programming with XML in the pdf
Ngày tải lên :
24/01/2014, 09:20
... Serializing Objects as XML 47
Course Evaluation 63
Programming with XML in the Microsoftđ .NET Framework ix
Trainer Materials Compact Disc Contents
The Trainer Materials compact disc contains ...
Lesson: Introduction to Querying XML Using XPath 2
Lesson: Creating and Navigating a Document Cache 9
Lesson: Executing Your Query 17
Review 33
Lab 5.1: Querying XML Documents Using XPath ... Programming with XML in the Microsoftđ .NET Framework iii
Contents
Introduction
Course Materials 2
Prerequisites 3
Course Outline 4
Setup 6
Microsoft Official Curriculum 7
Microsoft...
- 12
- 356
- 0
Tài liệu Practical C Programming Third Edition pdf
Ngày tải lên :
14/02/2014, 20:20
... generic cc compiler or the Free Software Foundation’s gcc
compiler. For MS-DOS/Windows users, instructions are included for Borland C+ +,
Turbo C+ +, and Microsoft Visual C+ +. (These compilers compile ... of many
chapters, you will find a section called Programming Exercises.” These sections
contain exercises that might be used in a programming class to test your knowl-
edge of C programming.
Notes ... entry for information on how to get their software.)
Among their offerings is a C compiler called gcc.
To compile a program using the gcc compiler use the following command line:
% gcc -g -Wall...
- 456
- 3K
- 7
Tài liệu Beej''''s Guide to C Programming pdf
Ngày tải lên :
16/02/2014, 08:20
... the same as a C string, except that it is, in fact, completely different.
A string in C is a sequence of bytes in memory that usually contains a bunch of letters.
Constant strings in C are surrounded ... new format specifiers for printf() here: %c for printing a single char, and %s
for printing a string! Ain't that exciting!)
And look here, we're accessing this string in a whole variety ... address-of operator.)
The increment() function gets a copy of the pointer on the stack. Both the original pointer
&i (in main()) and the copy of the pointer p (in increment()) point to the same address....
- 136
- 2.2K
- 1
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf
Ngày tải lên :
19/02/2014, 18:20
... GCG-3Â and
5Â-CCATCCGAATTCTCACTACACATTGAT CCTAGCA
GAAGC-3Â were used for the PCR amplication of the
C- terminal region of d1-EGFP corresponding to the mouse
ornithine decarboxylase PEST sequence ... 5Â-CTAGTCGTCCGAACTCCGATAATCGC
CGTCAGGGCGGTCGCGAACGTTTAG-3Â and 5Â-CA
TGCCAAACGT TCGCGA CCGC CCTGAC GGCGAT TA
TCGGAGTTCGGACA-3Â into the unique SpeI restriction
site. p13R4-DP was obtained by replacing the B10 tag of
the p13R4 construct with annealed ... (amino acids
422–461 [18]). The B10 tag was subsequently added to the
resulting plasmid by cloning the following annealed oligo-
nucleotides 5Â-CTAGTCGTCCGAACTCCGATAATCGC
CGTCAGGGCGGTCGCGAACGTTTAG-3Â...
- 14
- 483
- 0
Báo cáo khoa học: Kinetic deuterium isotope effects for 7-alkoxycoumarin O-dealkylation reactions catalyzed by human cytochromes P450 and in liver microsomes Rate-limiting C-H bond breaking in cytochrome P450 1A2 substrate oxidation pdf
Ngày tải lên :
16/03/2014, 13:20
... Enzymatic Reaction Mechanisms. W.H.
Freeman Co, San Francisco, CA, USA.
14 Miwa GT & Lu AYH (1987) Kinetic isotope effects and
‘metabolic switching’ in cytochrome P450-catalyzed
reactions. ... [19,27–29]. The existence of a
gem secondary kinetic isotope effect has the effect of
attenuating the rate of C- H bond-breaking, so in prin-
ciple the intrinsic kinetic isotope effect would be even
higher ... Kinetic deuterium isotope effects for 7-alkoxycoumarin
O-dealkylation reactions catalyzed by human cytochromes
P450 and in liver microsomes
Rate-limiting C- H bond breaking in cytochrome...
- 9
- 314
- 0
Programming Embedded Systems in C and C ++ docx
Ngày tải lên :
17/03/2014, 13:20
... Serial Controller 149
Chapter 10. Optimizing Your Code 151
10.1 Increasing Code Efficiency 151
10.2 Decreasing Code Size 154
10.3 Reducing Memory Usage 156
10.4 Limiting the Impact of C+ + 157 ... running the same software in a simulator. If
Programming Embedded Systems in C and C+ +
- 44 -
you should see is the C source code for main, with a cursor indicating that the embedded
processor's ... development, a special object file that contains the
compiled startup code must also be included within this list. (See Startup Code later in this
chapter.) The GNU linker also has a scripting language...
- 187
- 924
- 1
David haskins c programming in linux
Ngày tải lên :
19/03/2014, 14:07
...
Introduction
The teaching approach
I began university teaching later in life after a career programming in the telecommunications industry.
My concern has been to convey the sheer fun and creativity ... array of pointers to character
strings called argv[].
Download free books at BookBooN.com
C Programming in Linux
8
Introduction
Introduction
Why learn the C language?
Because the C language ... of my academic research and commercial consultancy has been involved with spatial systems
design and the large data volumes and necessary processing efficiency concerns has led me to
concentrate...
- 84
- 318
- 0
Báo cáo khoa học: Specific Ca2+-binding motif in the LH1 complex from photosynthetic bacterium Thermochromatium tepidum as revealed by optical spectroscopy and structural modeling pdf
Ngày tải lên :
30/03/2014, 02:20
... carbonyl of BChl a, the excitonic interaction among
the BChl a molecules in LH1, and deformation of the
BChl a macrocycle induced by Ca
2+
binding, all of
which may account for the low absorptive ... for Molecular Science, State Key Laboratory for Structural Chemistry of Unstable and Stable Species, Institute
of Chemistry, Chinese Academy of Sciences, China
Light-harvesting (LH) complexes ... structural modeling; light-harvesting–
reaction center core complex (LH1–RC);
photosynthetic purple bacterium;
Raman spectroscopy; Thermochromatium
(Tch.) tepidum
Correspondence
Z Y. Wang, Faculty...
- 11
- 392
- 0
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf
Ngày tải lên :
30/03/2014, 04:20
... following prim-
ers: 5Â-GCTTCAGCTGGGATCCGGTGGTATGGTGA G
CAAGG-3Â; and 5Â-CCAGATCGCGGCCGCTTAGTGG
TGATGATGGTGGTGATGATGCTTGTACAGCTCGT
CC-3Â. Following the His
8
-tag, a TAA stop codon was
inserted in ... primer,
5Â-TTTTCGTAAGCGCTTGCGCTGCAAGTTTCGGCAC
GAA-3Â; 2.5T sense primer, 5Â-GCGCAAGCGCTTACG
ACTTAAAAAAATTGGTCAGAAAATCCAGG-3Â; 2.5T
antisense primer, 5Â-CCTGGATTTTCTGACCAATTTTT
TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense ... primers
5Â-GCAGGTGTGAATTCCATGGTGAGCAAGGGCGAG
GAGC-3Â and 5Â-CCAGATCGCGGCCGCCTTGTACAG
CTCGTCATGCCGAGAG-3Â; EcoRI and ApaI restriction
enzyme sites were introduced into the 5Â-end and 3Â-end of
the Cerulean DNA fragment....
- 16
- 329
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
Ngày tải lên :
30/03/2014, 08:20
... has recently been shown that the
cysteine-rich domain of PC5 ⁄ 6A was responsible for
membrane tethering, thus insuring cell-surface anchor-
ing [37]. In other cases, the CT-peptide contains integ-
ral ... enzymatic analysis, and purification of
murine proprotein convertase-1 ⁄ 3 (PC1 ⁄ PC3) secreted
from recombinant baculovirus-infected insect cells.
Protein Expr Purif 14, 353–366.
8 Coates LC & ... that no conversion of prorenin into
renin by PC1 ⁄ 3 could be observed in the constitutive
secretory pathway of CHO cells, contrary to what is
observed in secretory granules containing GH4 cells.
Hence,...
- 10
- 305
- 0
Accelerate C in FPGA_7 pdf
Ngày tải lên :
20/06/2014, 08:20
... the num1 instance
must be boxed in order to acquire a reference to the IComparable interface on it. Secondly, because
CompareTo accepts a reference of type System.Object, the num2 instance must ... reference that points to the same object. Consider the following code:
public class EntryPoint
{
static void Main()
{
object referenceA = new System.Object();
object referenceB = referenceA; ... System.Convert when casting won’t do
the trick. Moreover, your custom objects, such as the ComplexNumber class, should implement
IConvertible so they can work in concert with the System.Convert class....
- 59
- 246
- 0
Professional ASP.NET 3.5 in C# and Visual Basic Part 6 pdf
Ngày tải lên :
05/07/2014, 18:20
... use an inline coding model because it works
well in showing an example in one listing. Even though the example is using an inline coding style, it is
my recommendation that you move the code to ... partial classes. Partial classes enable you to separate your classes into multi-
ple class files, which are then combined into a single class when the application is compiled. Because
ASP.NET 3.5 combines ... having everything in a single viewable instance makes working
with the ASP.NET page easier. Another great thing is that Visual Studio 2008 provides IntelliSense when
working with the inline coding...
- 10
- 491
- 0
Professional ASP.NET 3.5 in C# and Visual Basic Part 23 pdf
Ngày tải lên :
05/07/2014, 18:20
... step in the series. This event
simply covers each step change generically.
CancelButtonClick
Triggers when the end user clicks the Cancel button in the navigation
system.
FinishButtonClick
Triggers ... Turning sections on and off, which means activating or deactivating a series o f
View controls within a MultiView control, is similar to changing the visibility of Panel controls. For
certain ... <
asp:WizardSteps
> control. Each step contains
content — simply text in this case, although you can put in anything you want, such as other Web server
controls or even user controls. The order in which the
WizardSteps
are...
- 10
- 409
- 1
