c private disclosures by connected exempt fund managers with nointerests in securities of any party to the offer representing 1 ormore
An analysis of errors related to the uses of english prepositions at, on, in produced by elementary level students at foreign languages & informatics center vinh city
... place) • I left my coat behind in the office (the office is considered as a building) • There’s a good film at the cinema (the cinema as a public place for seeing films) • It was very cold in the ... (prisoner) in the river / the lake / the sea / the at the seaside / at sea ocean at the top of the page / of + N 24 at the end of the road at the corner of the street in the corner of the room at the ... out of, up to etc, VERB/ADJECTIVE/ CONJUNCTION + PREP as owning to, due to, because of etc, PREP + NOUN + PREP as by means of, in comparison with, in front of, etc 17 2.7.2 Semantic Characteristics...
- 67
- 705
- 3
Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt
... the cytosolic TK1 and the mitochondrial TK2 (EC 2.7 .1. 21 for both TK1 and TK2), encoded by two nuclear genes TK1 is cell-cycle-speci c and is not expressed in quiescent cells, in which only the ... pools [10 ] TK1 is degraded to undetectable levels during mitosis by means of the anaphase-promoting complex APC ⁄ C- Cdh1, which recognizes a KEN box in the C- terminus [11 ] Human TK1 (hTK1) is ... tuning of the hTK1 activity during the cell cycle When hTK1 is degraded in G2 ⁄ M phase, and given that ATP is fairly constant during the cell cycle, the initial low hTK1 concentration in the...
- 10
- 647
- 0
Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf
... guanylyl cyclase activity, 50% of the activity seen in control cells was still observed, representing the amount of GC -C detected by ST binding (Fig 2C) Therefore, the fraction of GC -C present in the ... mixture F12 in the ratio : (DMEM/F12) containing 10 % fetal bovine serum, nonessential amino acids, 12 0 mgÆL )1 penicillin and 270 mgÆL )1 streptomycin To allow differentiation of Caco2 cells into intestinal ... enterocytes [17 ] GC -C has been cloned [18 ] and characterized from Caco2 cells [19 ], and Caco2 cells express lower levels of GC -C in comparison to T84 cells [14 ] GC -C expression levels increase...
- 10
- 427
- 0
Báo cáo khoa học: Recruitment of coregulator complexes to the b-globin gene locus by TFII-I and upstream stimulatory factor doc
... (upstream: 5¢-CCTTCA GCAGTTCCACACAC-3¢, downstream: 5¢-CTCCTCTGT GAAATGACCCA-3¢); human HS3 ⁄ (upstream: 5¢-GTG ACCTCAGTGCCTCAGAA-3¢, downstream: 5¢-ACCTAT CACAGCACCACACC-3¢); and human glyceraldehyde ... (upstream: 5¢-ATGACCTGGCTCCACC CAT-3¢, downstream: 5¢-TCTTTGAGCCATTGGTCAGC3¢); human HS2 (upstream: 5¢-CGCCTTCTGGTTCTGTG TAA-3¢, downstream: 5¢-GAGAACATCTGGGCACAC AC-3¢); human c- globin promoter (upstream: ... the recruitment of macromolecular complexes involved in chromatin structure alterations and transcription [16 ,17 ] Regulation of the globin genes involves the action of many transcription factors,...
- 9
- 312
- 0
Báo cáo khoa học: Catalytic activation of human glucokinase by substrate binding – residue contacts involved in the binding of D-glucose to the super-open form and conformational transitions ppt
... particular interest in the present context due to its connection to the two Glc contact residues N204 and I 211 Y 215 210 Fig Main interhelical contacts between helix (D205-Y 215 ) and the C- terminal ... change noticeably upon Glc binding (Fig 8B ,C) The changes in the interhelical interactions point to a major contribution in the dynamic communication between the L- and S-domains and thus in the transition ... Fluorescence difference Fluorescence difference A J Molnes et al D-glucose-induced conformational dynamics The time course of the fluorescence enhancement induced by Glc was followed on a second -to- minute...
- 15
- 522
- 0
báo cáo hóa học:" Antemortem diagnosis of asbestosis by screening chest radiograph correlated with postmortem histologic features of asbestosis: a study of 273 cases" docx
... regarding the clinical diagnosis of asbestosis [3] This statement concludes that there must be evidence of structural pathology of the lung documented by imaging or histology, evidence of causation ... diagnosis of asbestosis These 31 cases were used as a control group For each of the 273 cases, the age and gender of the patient were recorded along with the presence or absence of the following: history ... Since the 19 50s, the International Labor Office (ILO) classification scheme for pneumoconiosis has standardized the radiographic diagnosis of asbestosis [1] This system, when combined with the...
- 5
- 221
- 0
Báo cáo hóa học: " Research Article Packet-Scheduling Algorithm by the Ratio of Transmit Power to the Transmission Bits in 3GPP LTE Downlink" pptx
... Networking Normalised throughput 0.2 0 .1 0.2 0 .1 0.2 0 .1 0.2 0 .1 Conclusion 10 11 12 13 14 15 10 11 12 13 14 15 10 11 12 13 14 15 10 11 12 13 14 15 Index number of user equipments MT-MT RR-RR PF-PF ... and the packet scheduler calculates packet scheduling metrics 2 .1 Classifier In Figure 1, the classifier classifies the mixed tra c at Layer data buffer according to the type of tra c Because each ... becoming scheduling candidates to the FDPS In the FDPS, the PRBs at Layer are directly allocated to the SCS received from the TDPS In a mixed tra c system, a classifier is necessary for the efficiency...
- 8
- 432
- 0
Báo cáo y học: " HIV-1 neutralization by monoclonal antibody against conserved region 2 and patterns of epitope exposure on the surface of native viruses" pot
... from C1 E1 and C1 E2 represented amino acids 93 -11 2 of the C1 region, whereas peptides C2 E represented amino acids 218 -240 of the C2 region Antibody titers of sera from mice immunized with C1 E1, C1 E2, ... to design synthetic peptides We found that synthetic peptides representing amino acids 93 -11 2 (C1 E1 and C1 E2) of C1 and 218 -239 (C2 E) of C2 regions could absorb NAbs in sera collected from Thai ... frequency than in the C1 E peptides The C2 E ( 218 -239) epitope is located around a βturn near the loop α domain and C1 E (93 -11 2) spans the coil region located in the inner domain of gp120 These...
- 8
- 445
- 0
Bees and their role in forest livelihoods A guide to the services provided by bees and the sustainable harvesting, processing and marketing of their products
... foundation 11 0 11 0 11 0 11 1 11 1 11 1 11 1 11 OTHER PRODUCTS FROM BEES Pollen Propolis Royal jelly Minor products 11 3 11 3 11 4 11 7 11 8 12 APITHERAPY Honey as medicine Naturally occurring antibiotic in honey ... marketing of honey Payment methods and delivery terms 13 1 13 1 13 2 13 3 13 3 13 3 13 4 13 5 13 6 14 2 14 2 14 4 14 5 15 CONSTRAINTS TO DEVELOPMENT The nature of constraints facing beekeepers in developing countries ... Honey to reduce allergic responses Beeswax Pollen Propolis Royal jelly Bee venom therapy 11 9 11 9 12 0 12 0 12 0 12 1 12 1 12 1 12 1 13 VALUE-ADDED PRODUCTS Value-addition Add profit by increasing product...
- 204
- 383
- 0
Tài liệu Dodd-Frank Act Changes Affecting Private Fund Managers and Other Investment Advisers pptx
... U.S financial stability.70 IV Other Changes Impacting Private Funds A Changes to the Definition of “Accredited Investor” Effective July 21, 2 010 , the definition of “accredited investor,” which defines ... as to funds managed by a registered investment adviser, if an investor met the qualified client standard in effect at the time of its investment into the fund, then the investor can remain in the ... Investment Company Act of 19 40, as amended (the “Investment Company Act”), but for section 3 (c) (1) or 3 (c) (7) of the Investment Company Act, or “such similar funds” as the appropriate regulator may, by...
- 6
- 463
- 0
Tài liệu Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on Alternative Investment Fund Managers and amending Directives 2004/39/EC and 2009/…/EC ppt
... transmission and filing of the documents referred to in paragraph is accepted by their competent authorities In the event of a change in any of the particulars communicated in accordance with paragraph ... points (b), (c) and (e) to (h) of Article of Second Council Directive 77/ 91/ EEC of 13 December 19 76 on coordination of safeguards which, for the protection of the interests of members and others, are ... of investors with a view to investing it in accordance with a defined investment policy on the principle of riskspreading for the benefit of those investors This Directive should not apply to the...
- 54
- 755
- 0
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt
... pair 5¢-GCAGCGGCAC CTCTTCTCACGCCGCAGGCTTG-3¢ and 5¢-CAAG CCTGCGGCGTGAGAAGAGGTGCCGCTGC-3¢ for the W66S mutant, and by using the primer pair 5¢-GCCACCTCTTTCCACGCCGCAGGC-3¢ and 5¢-GC CTGCGGCGTGGAAAGAGGTGCC-3¢ ... (Stratagene), according to the instructions of the supplier, and by using the primer pair 5¢GGCACCTCTTGGGCCGCCGCAGGC-3¢ and 5¢-GCC TGCGGCGGCCCAAGAGGTGCC-3¢ for the H67A mutant, by using the primer ... or covalent binding of FAD to MABO was determined by precipitation of the protein with trichloroacetic acid, and by the flavin fluorescence, in 10 % (v/v) acetic acid, of the precipitated protein...
- 8
- 647
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG ... calculated a decaheme cytochrome c content (OmcA + OmcB) in MR-1R of about 6.68 pmol per 10 9 cells This value matches the sum of both decaheme cytochrome c concentrations in the respective single ... UK) in the absence and the presence of a few crystals of sodium dithionite (Sigma-Aldrich) The decaheme cytochrome c concentration was calculated as explained in Results, taking into account 10 ...
- 11
- 731
- 0
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx
... hence, promoting binding to the target (e.g [13 ,16 ,17 ]) Binding to the target can increase the Ca2+-binding affinity to CaM further [17 ,18 ] In addition, subsequent binding of Ca2+ to the N-lobe then ... lack of structural information on the cytosolic channel domains in complex with CaM Initiated by the finding that hEAG1 channels lacking the entire N-terminal cytosolic domain are insensitive to ... heteromeric association complex with the C- terminal domain of Ca2+-free CaM, i.e apoCaM The activation of these channels is mediated by conformational changes in the CaM ⁄ SK2 complex induced by binding...
- 13
- 500
- 0
THE EU ALTERNATIVE INVESTMENT FUND MANAGERS DIRECTIVE: IMPACT ON NON-EU FUND MANAGERS ppt
... in respect of the marketing of AIFs to investors in their territories WHAT DOES MARKETING COVER? For the purposes of the Directive marketing extends to the direct or indirect offering or placing ... subject to detailed rules made by the EU Commission The accounting information in the report will need to be prepared in accordance with accounting standards of the jurisdiction in which the AIF ... particular relevance in the context of an offering or placing in the EU which has commenced before 22 July 2 013 but which has not finally closed by that date; C& B COVINGTON & BURLING LLP if the...
- 9
- 476
- 0
Alternative Investment Fund Managers Directive (“AIFMD”), Level 2 Measures - The Wait Is Over ppt
... not the combined AUM of any other funds managed by the investment manager To avoid double counting, holdings in other AIFs are excluded from the calculation as well as any UCITS managed by the ... but to delegate its custody duties to a third party In particular, this shall be the case if the law of the third country requires that certain financial instruments are held in custody by a local ... to the depositary, describe the oversight functions, describe the due diligence process for the selection of delegates including the monitoring of the segregation obligation and set out the contractual...
- 6
- 521
- 0
Exemptions for Advisers to Venture Capital Funds, Private Fund Advisers With Less Than $150 Million in Assets Under Management, and Foreign Private Advisers pptx
... ―has the same meaning as in section 3(a) (11 ) of the Securities Exchange Act of 19 34 (15 U.S .C 7 8c( a) (11 )) and § 240.3a 11- 1 of this chapter.‖) See 15 U.S .C 7 8c( a) (11 ) (defining ―equity security‖ ... qualifying fund to acquire securities in connection with the acquisition (or merger) of a qualifying portfolio company by another company ,11 1 without jeopardizing the fund s ability to satisfy the ... security in section 3(a) (11 ) of the Exchange Act and rule 3a 11- 1 thereunder.95 Accordingly, equity security includes common stock as well as preferred stock, warrants and other securities convertible...
- 208
- 400
- 0
Koenig, moo accelerated c++ practical programming by example
... management 10 .7 Details Chapter 11 Defining abstract data types 11 .1 The Vec class 11 .2 Implementing the Vec class 11 .3 Copy control 11 .4 Dynamic Vecs 11 .5 Flexible memory management 11 .6 Details Chapter ... what to about it We begin by testing whether we are about to write the first character of the greeting, which we by finding if we're in the correct row and on the correct column within that row The ... or the end of the line) from the input, then reads characters into name until it encounters another whitespace character or end -of- file Therefore, the result of executing std::cin >> name is to...
- 453
- 611
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25