c n and o
Photocatalytic Degradation of Isoproturon Pesticide on C, N and S Doped TiO2
Ngày tải lên :
26/03/2014, 00:20
... [26] F Dong, W Zhao, and Z Wu, “Characterization and photocatalytic activities of C, N and S co-doped TiO2 with 1D nanostructure prepared by the nano-confinement effect,” Nanotechnology, Vol 19, ... groups present in TCNS5 and they are absent in TCNS0 which shows successful doping of nitrogen into the lattice of TiO2 [33,34] No peak corresponding to NH4+ absence (3189 and 1400 cm-1) shows ... concentration is an important parameter for photocatalytic degradation activity over known catalyst amount The 7.28×10−5, 1.14×10−4 and 2.42×10−4 M concentrations of isoproturon are studied over...
- 10
- 358
- 0
Alpha fluorinated aromatic ketone as nucleophile in asymmetric organocatalytic c n and c c bonds formation reactions 2
Ngày tải lên :
10/09/2015, 15:51
... deprotonation/deuteriation process 2.2 Enantioselective H/D exchange of -fluorinated aromatic ketones 2.2.1 Synthesis of -fluorinated aromatic cyclic ketones and chiral bicyclic guanidine catalyst ... Enantioselective H/D exchange reaction 2.1 Introduction Hydrogen/deuterium (H/D) exchange between organic compounds and deuterium sources is very important for a wide range of applications such ... bicyclic guanidine 25 catalyzed asymmetric H/D exchange reaction in different conditions 7-Bromo-2-fluoro-3,4-dihydronaphthalen-1(2H)-one 82a was selected for the model H/D exchange reaction catalyzed...
- 14
- 176
- 0
Alpha fluorinated aromatic ketone as nucleophile in asymmetric organocatalytic c n and c c bonds formation reactions 4
Ngày tải lên :
10/09/2015, 15:51
... COOH NHCO2tBu H O OtBu 112 unstable H C COOH NCO2tBu OEt COOEt NHCO2tBu 114 113 decomposition products Scheme 3.10 Dehydrofluorination of 109 under acidic conditions F H CO2Et N( CO2Bn)2 CF3CO2D ... Enatioselective C- N bond formation 3.1 Introduction The catalytic, enantioselective, direct C- N bond formation reaction using carbonyl compounds and nitrogen sources, such as azodicarboxylates, ... conditions In considering unfavorable acidic conditions, they tried neutral conditions for 57 Enatioselective C- N bond formation N- deprotection (Scheme 3.11) Treatment of compound 115 with CF3CO2D...
- 28
- 324
- 0
Alpha fluorinated aromatic ketone as nucleophile in asymmetric organocatalytic c n and c c bonds formation reactions 4a
Ngày tải lên :
10/09/2015, 15:51
... Enatioselective C- C bond formation 4.1 Introduction Asymmetric C- C bond formation reactions are important reactions in organic synthesis Among the various asymmetric organic reaction, asymmetric ... Deng et al reported the highly enantioselective and diastereoselective tandem conjugate addition and protonation of -cyano ketones 145 and -chloroacrylonitrile 146 The -cyano ketones 145 of ... asymmetric Mannich and Michael reactions are much more useful reactions for preparation of chiral functionalized organic molecules Recently, more efforts were donated to the development of efficient chiral...
- 18
- 249
- 0
Alpha fluorinated aromatic ketone as nucleophile in asymmetric organocatalytic c n and c c bonds formation reactions 5
Ngày tải lên :
10/09/2015, 15:51
... 124.3 min; minor isomer: 132.8 5.4 Protocol for bicyclic guanidine catalyzed asymmetric C- N bond formation reaction and characterization of products 2-Fluoro-3,4-dihydronaphthalen-1(2H)-one 82d ... Experimental Colorless oil LRMS (ESI) m/z 551.3 (M+Na+); 5.5 Protocol for bicyclic guanidine catalyzed asymmetric C- C bond formation reactions and characterization of products Procedures for the ... from Na/benzophenone MeCN and CHCl3 were distilled from CaH2 MeOH was distilled from Mg 5.2 Preparation and Characterization of Substrates and catalysts 5.2.1 Preparation and characterization of...
- 54
- 293
- 0
Alpha fluorinated aromatic ketone as nucleophile in asymmetric organocatalytic c n and c c bonds formation reactions
Ngày tải lên :
10/09/2015, 15:51
... 1,3-dicarbonyl compounds are much more reactive fluorocarbon nucleophiles for some asymmetric transformations in the presence of chiral metal complexes or organocatalysts Introduction O O O R1 R2 N ... asymmetric conjugated addition reactions Most aliphatic ketone and acetophenone nucleophiles used in organocatalytic asymmetric transformations rely on the formation of highly reactive enamine intermediates.1 ... Asymmetric Mannich reaction of -fluoro-β-ketoesters Fluorocarbon nucleophile are also excellent nucleophiles for Mannich reaction under chiral organic base catalysts Lu and co-workers20 reported...
- 26
- 319
- 0
Chemistry of cyclopentadienylchromium complexes containing c , n and s organic ligands
Ngày tải lên :
03/10/2015, 20:33
... I OC CO OC Cr Cr RSSR Cr OC OC H2S Cr CO OC CO SR CO OC OC + HS H CO RX Bu3SnH RSH + Cr OC OC SnBu3 CO Cr OC OC + Cr OC OC H CO Cr OC OC Cr OC OC R CO Cr + SR CO X CO OC OC H CO The wide range ... As Cr Cr OC CO As As As + OC CO OC CO As Cr Cr OC CO X = S, Se Cr As As As As As Cr X Cr X OC CO Cp4Cr4S4 Cr OC CO S8 or Se2 As OC CO OC Cr Cr CO OC CO P4 P Cr P P Cr OC CO CO OC Cr P P OC P Cr ... and S- Organic Ligands 28 Chapter 1: Introduction Tetrazole complexes Scheme 1.3.9 N N N N CF3 N N CF3 N + + Na BrMn(CO)5 N Mn OC OC CO CF3 C N N CO OC O C N N OC Mn Mn + THF Mn(CO)3 CO OC N N...
- 150
- 357
- 0
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
Ngày tải lên :
19/02/2014, 02:20
... taken into account when studying the expression and regulation of PrPC in consideration of the di-, mono- and nonglycosylated protein bands For distinct discrimination among various species, such ... endogenous proteolytic modifications, which occurs in vivo [25–27] PrPC from non-infected brains consists in addition to full-length PrP to a significant amount of an N- terminal truncated PrPC ... determine the linear range of reaction (C) For glycotyping, the combined PrP signals for the di- (d), mono- (j) and nonglycosylated (m) isoform were defined as 100% and the contribution of each band...
- 11
- 536
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
Ngày tải lên :
20/02/2014, 01:20
... simultaneous centrifugation of the sample containing no actin-tropomyosin under the same conditions Reconstitution of troponins Recombinant TnI-fragment and native TnC and TnT were mixed at a : : molar ... then run on SDS ⁄ PAGE Lanes a and d, in the absence of both TnC and Ca2+; lanes b and e, in the presence of TnC and the absence of Ca2+; lanes c and f, in the presence of both TnC and Ca2+ Ac, ... (A and C) and Akazara scallop (B and D) reconstituted troponins The effects of the troponin containing TnI or TnI fragments on the actomyosintropomyosin Mg-ATPase were measured as a function of...
- 12
- 514
- 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot
Ngày tải lên :
07/03/2014, 11:20
... opened the door, and the two ladies went out, Monica not once looking up No sooner had they gone than Carmona walked to the window, and seeing me in the glimmering night joined me “This is my mother's ... you knew all.” “I know At least—I mean—but of course, I oughtn't to be here with you.” “According to convention you oughtn't Yet—” “I'm not thinking of conventions But—oh, I should hate you to ... The Car of Destiny wondered, knowing the traditions of our family, many of them tragic, when love would come to me Now it had come quickly, in a moment; but not to go as it had come It and I would...
- 424
- 1.3K
- 0
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx
Ngày tải lên :
07/03/2014, 12:20
... Binding of MCGS-(H)6-hCaM to fusion proteins of cytosolic hEAG1 domains Dissociation constants KD for binding of TMR-MCGS(H)6-hCaM to the indicated constructs in the absence and presence of 25 ... importance of Ca2+-binding ability of EF-hand motifs and in CaM for its interaction with the channel Calmodulin binding to hEAG1 channels by voltage To test for such a scenario, channel mutants ... likely scenario, because in precipitation assays with N- and C- terminal protein fragments of hEAG1 we could not detect interaction, neither alone nor in the presence of CaM (not shown) In addition,...
- 13
- 500
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
Ngày tải lên :
07/03/2014, 15:20
... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC ... S2 cells and functional transcription of GCPII-coding sequences (data not shown) Inhibition of proteasome degradation As the mRNAs encoding the 274/587 and 274/750 variants, but no corresponding ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...
- 9
- 414
- 0
![Lecture notes on c algebras and quantum mechanics [jnl article] n lamdsman](https://media.store123doc.com/images/document/14/rc/rt/medium_6PjfnHupCQ.jpg)
Lecture notes on c algebras and quantum mechanics [jnl article] n lamdsman
Ngày tải lên :
17/03/2014, 14:41
... Rham) cohomology theory, whose non-commutative version is called cyclic cohomology Finally, homology, cohomology, K -theory, and index theory haven been uni ed and made non-commutative in the ... The precise connection between von Neumann algebras and the decomposition of unitary group representations envisaged by von Neumann was worked out by Mackey, Mautner, Godement, and Adel'son-Vel'skii ... projections in the sense of Murray and von Neumann, and I is in nite The range of d is 1] 10 HISTORICAL NOTES type III: M has no minimal projections, all nonzero projections are in nite-dimensional...
- 89
- 447
- 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf
Ngày tải lên :
22/03/2014, 21:20
... (A) or St3.3 (B) bound to Ni2+ resin Lane (A and B), absence of nonspecifically bound CD (control) At the bottom of each lane, a western blot analysis illustrating the presence of CD is shown (C) ... grateful to Jose Luis Burgos [Comision de Investigaciones Cientificas (CIC)] for excellent technical assistance and Dr Marı´ a Corvi for helpful discussions and critical reading of the manuscript ... present in A thaliana SSIII Computational predictions identified coiled-coil domains in the SSIIIHD region that could explain both protein recognition and glucan binding [35] Thus, it has been proposed...
- 13
- 457
- 0
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
Ngày tải lên :
23/03/2014, 13:20
... helix and the latter does not contain it Overproduction and purification Upon induction for overproduction at 10 C, N- domain+ and C- domain+ accumulated in the cells in a soluble form, whereas C- domain– ... proteins are composed of N- and C- domains, which are spanned by a 40 amino acid long a3 helix The N- domain consists of a1 and a2 helices and an N- terminal region of a3 helix The C- domain consists ... helix spans both the N- and C- domains, and because the region containing only a1 and a2 helices seems to be too short to fold correctly, N- domain+ was designed such that it contains the entire a3...
- 11
- 332
- 0
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx
Ngày tải lên :
30/03/2014, 20:20
... sequences and was not modeled, however, the region may contribute to stability by increasing intersubunit contacts in oligomers p26 possesses four short loops and of these loop containing b-strand ... effect on oligomerization and chaperone activity, suggesting limited involvement of loop in protein stability and function Loops and were not affected by internal deletions, nor were equivalent ... localization in mammalian cells In order to examine oligomerization and cell localization, both interesting in the context of Artemia embryo development and sHSP function, mammalian cells were transfected...
- 14
- 358
- 0
Báo cáo khoa học: Comparative analysis of the site-specific N-glycosylation of human lactoferrin produced in maize and tobacco plants pdf
Ngày tải lên :
31/03/2014, 07:20
... W.J., Bosch, D & Lommen, A (2001) Influence of growth conditions and developmental stage on N- glycan heterogeneity of transgenic immunoglobulin G and endogenous proteins in tobacco leaves Plant Physiol ... by using 0.2% (w/v) orcinol in a 60% (v/v) sulphuric acid solution Enzymatic deglycosylation of glycopeptides Isolation of hLf cDNA and vector construction hLf cDNA was according to Salmon et ... recently shown that the developmental stage of tobacco leaves influences the N- glycosylation of transgenic IgG, with a higher proportion of GlcNAc-containing glycans in older leaves compared to...
- 8
- 426
- 0
Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx
Ngày tải lên :
31/03/2014, 09:20
... Venturoli, G & Melandri, B.A (1989) Reconstitution of cyclic electron transport and photophosphorylation by incorporation of the reaction center, cytochrome bc1 complex and ATP synthase from ... depends on the redox state of the ubiquinone pool and on the ubiquinone/RC stoichiometry [2,25] For a normal size of ubiquinone pool (% 25 ubiquinone molecules/RC)1), upon decreasing the ambient ... subunit of the LH1 complex However a significant efficiency of PufXD2)26 insertion in the core complex seems unlikely, due to the nonphotosynthetic phenotype of this strain and to the pronunced...
- 9
- 547
- 0
SOLVABILITY CONDITIONS FOR SOME DIFFERENCE OPERATORS N. C. APREUTESEI AND V. A. VOLPERT Received 24 docx
Ngày tải lên :
23/06/2014, 00:20
... Fredholm operator and its index is zero In Section we prove that under some conditions on the polynomials P + and P − corresponding to operator L in (1.1), the bounded solutions of the equation ... also invertible Hence the index of L+ is zero 1 Since the continuous deformation Pτ does not have solutions σ with |σ | = 1, we find that the corresponding continuous deformation of the operator ... has nonzero bounded solutions if and only if the corresponding algebraic polynomial P + has a root σ with |σ | = We will find conditions in terms of P + for the limiting operator L+ to be invertible...
- 13
- 187
- 0
EXPONENTIAL STABILITY OF DYNAMIC EQUATIONS ON TIME SCALES ALLAN C. PETERSON AND YOUSSEF N. RAFFOUL pdf
Ngày tải lên :
23/06/2014, 00:20
... depends on t (and x of course) when the graininess function of ˙ T is nonconstant Several formulas are given in Peterson and Tisdell [7] for V (t,x) for various type I Lyapunov functions V (x) In ... Mathematics and Its Applications, vol 370, Kluwer Academic Publishers, Dordrecht, 1996 A C Peterson and C C Tisdell, Boundedness and uniqueness of solutions to dynamic equations on time scales, ... solution to (1.1) is exponentially or uniformly exponentially stable on [0, ∞) Some of our results are new even for the special cases T = R and T = Z To understand the notation used above and...
- 12
- 302
- 0