c fos expression and neuronal firing
Báo cáo khoa học: Endogenous mono-ADP-ribosylation mediates smooth muscle cell proliferation and migration via protein kinase N-dependent induction of c-fos expression potx
... TCCATGGTGGTGAAGAC-3¢); c- fos (sense: 5¢-GAATA AGATGGCTGCAGCCAAGTGC-3¢, antisense: 5¢-AAG GAAGACGTGTAAGCAGTGCAGC-3¢), and c- myc (sense: 5¢-AAGTTGGACAGTGGCAGGGT-3¢, antisense: 5¢-TTGCTCCTCTGCTTGGACAG-3¢) Amplification ... according to the protocol recommended for the GeneAmp kit with oligodeoxynucleotide primers speci c for GAPDH (sense: 5¢-CGGTGTG AACGGATTTGGCCGTAT-3¢, antisense: 5¢-AGCCTTC TCCATGGTGGTGAAGAC-3¢); ... addition of mL cold 20% trichloroacetic acid and the precipitate was captured on GF /C glass fibre filters The filters were washed extensively with 5% trichloroacetic acid and the radioactivity was...
- 10
- 389
- 0
![Báo cáo khoa học: [Na+]i-induced c-Fos expression is not mediated by activation of the 5¢-promoter containing known transcriptional elements ppt](https://media.store123doc.com/images/document/14/rc/kt/small_AqRuqpZDo1.jpg)
Báo cáo khoa học: [Na+]i-induced c-Fos expression is not mediated by activation of the 5¢-promoter containing known transcriptional elements ppt
... amplified by PCR from human HeLa cell genomic DNA, using TCGCTAGCGTCTGCTTCCACGCTTTGCACT and ACAGATCTGCTGTGGAGCAGAGCTGGGTA primers bearing NheI and BglII restriction sites, respectively c- Fos promoter ... GF HeLa C1 1-MDCK VSMC Fig Effect of ouabain and serum on the ratio of firefly luciferase (F-luc) and Renilla luciferase (R-luc) luminescence in HeLa cells, C1 1-MDCK cells and VSMCs The cells were ... chelators on c- Fos expression in control and ouabain-treated cells (B) Immunoreactive c- Fos content in the absence and presence of ouabain, EGTA and BAPTA Cells were treated with 10 lM ouabain in control...
- 11
- 449
- 0
Báo cáo y học: "Mechanical signals control SOX-9, VEGF, and c-Myc expression and cell proliferation during inflammation via integrin-linked kinase, B-Raf, and ERK1/2-dependent signaling in articular chondrocytes" pot
... (antisense) TGCTCATCTGCTTGAACGGAC, and rat SOX-9 (sense) ATCTGAAGAAGGAGAGCGAG and (antisense) CAAGCTCTGGAGACTGCTGA Collected data were analyzed by the comparative threshold cycle method [26] Cell proliferation ... amplify the cDNA (SYBR Green Master Mix; Bio-Rad Laboratories, Inc.) were rat VEGF (sense) GCCTTGTTCAGAGCGGAGAAA and (anti-sense) CGCGAGTCTGTGTTTTTGCA, rat MYC (sense) GGAAAACAACGAAAAGGCCC and (antisense) ... http://arthritis-research.com/content/12/3/R106 (a) (d) Page of (b) (c) (e) (f) Figure Mechanical signals upregulate articular chondrocyte (AC) proliferation via SOX-9, VEGF, and c- Myc mRNA expression and ERK1/ activation...
- 9
- 259
- 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot
... 5¢-CTCCCTGGTCTCTCATCTGTCCTTCCCA CC-3¢; Myb3 Se, 5¢-CCTCCTGAGGCTTCCATCTGGCG GCCGCGG-3¢) Mutations were confirmed by nucleotide sequencing Transfection and luciferase activity assays Cells were cotransfected ... Clara, CA, USA) (primers: AP-1 Se, 5¢-CCGTCAGCGGT GACTTGGATTCACAGAGAC-3¢; FOXO Se, 5¢-CAAGT CACTAGGGTACCCACGCCGGGGTGG-3¢; Myb1 Se, 5¢-GACCAAGATGGTCCATCGGTGGGACGACAG-3¢; Myb2 Se, 5¢-CTCCCTGGTCTCTCATCTGTCCTTCCCA ... 5¢-CCAGACAATCGTCTCGCCCA-3¢; and Rv, 5¢-GGCTAGGTAACAGTTTAGCGAGGA-3¢) Rat genomic DNA extracted from rat primary hepatocytes was used as a positive control PCR products were analyzed by electrophoresis...
- 9
- 556
- 0
Báo cáo y học: "The expression and significance of protooncogene c-fos in viral myocarditis" pot
... NT, Chen WJ, Juan CC: Vitamin K3-induced cell cycle arrest and apoptotic cell death are accompanied by altered expression of c- fos and c- myc in nasopharyngeal carcinoma cells Oncogene 1993, 8:2237-2239 ... lymphocytes and macrophages in and around the necrotic foci Infiltration of the inflammatory cells and necrotic areas were decreased, and necrotic myocardium gradually changed to fibrosis and calcification ... other cytokines induce expression of c- fos and the c- jun oncogene [22-25], we deduced that abnormal expression of c- Fos can be observed in VMC In our experiment, protein expression of c- Fos increased...
- 7
- 384
- 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt
... same sample Speci c primers directed against human sequences for c- myc and GAPDH and PCR conditions were as previously described [20] Analysis of c- myc gene transcription by nuclear runoff assay ... each primer pairs by using 0.5 lCi of [a-32P]dCTP (speci c activity 3000 CiÆmmol)1, Amersham Pharmacia Biotech) and establishing the point at which exponential accumulation plateaus Using 30 PCR ... serum-cultured cells Since both PD98059 and NAMI-A could not completely inhibit c- myc gene expression in serum-cultured cells, it is possible that protooncogene expression may also have been induced...
- 10
- 703
- 0
Báo cáo khoa học: Vanadium-induced apoptosis of HaCaT cells is mediated by c-fos and involves nuclear accumulation of clusterin pptx
... against cyclin D1 (sc-20044), cyclin E (sc-481), E2F1 (sc-251), p21Cip1 ⁄ Waf1 (sc-817, sc-6246), Bcl-2 (sc-509), p27Kip1 (sc-1641, sc-528), c- fos (sc-7202) and CLU (sc-6419) were from Santa Cruz ... psCLU and sCLU (Fig 6A, compare lanes and 2) To further verify this differential expression of CLU, cytoplasmic and nuclear extracts and total A B C B C Fig Bcl-2 but not sCLU protected HaCaT cells ... keratinocyte pooled cell lines Generation of the nCLU (C1 20) plasmid and nCLU (C1 20)-expressing HaCaT cells Using speci c primers: (C1 20, HindIII, forward, 5¢-CGAA TTCGCGGAAGCTTCATGTCTGTGGACT-3¢; and...
- 16
- 312
- 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc ... cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058 B -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC...
- 11
- 527
- 0
Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc
... manufacturer as a control Transfectants were selected by blasticidin and expanded to suspension cultures COS7 cells were transfected with pcDNA3.1-CCbx-V5/ His using the empty vector as a control Cells ... fluoride and 20% (v/v) glycerol and sonicated COS7 cells (5 · 106 cells) were washed with NaCl/Pi, trypsinized and collected in NaCl/Pi (pH 7.2) containing 20% glycerol and · PIC Cells were homogenized ... LKRTIRTRLNIR ECCEDGWCCTAA LKRTIRTRLNIRECCEDGWCCTAA ARTKTDDDVPLSSLRDNLKRTIRTRLNIRECCEDGWCCTAA containing 0.1% (w/v) Chaps, 0.1% (w/v) phosphatidylcholine, 0.1 mM phenylmethanesulfonyl fluoride and 20%...
- 11
- 537
- 0
Báo cáo khoa học: Cellular retinol-binding protein type II (CRBPII) in adult zebrafish (Danio rerio) cDNA sequence, tissue-specific expression and gene linkage analysis pptx
... MgCl2, 0.4 lM sense primer (5¢-TTCGCCACCCGTAAGATC-3¢), 0.4 lM antisense primer (5¢-AAACTCCTCTCCAATGACG-3¢), 0.2 mM Fig Nucleotide sequence of a cDNA clone coding for a zebrafish CRBPII The complete ... hybrid panel was scored and then analyzed according to the directions at (http://mgcdh1.nichd.nih.gov:8000/zfrh/beta.cgi) PCR primers (5¢-CCAGCACATCCAGCTTC-3¢) and (5¢-GCCTGTTTGGAGCATTAG-3¢) (see ... with other CRBPs, CRABPs, and FABPs The amino-acid sequences of zebrafish CRBPII (ZbfshCRBPII; GenBank Accession number AF363957), chicken CRBPII (ChickCRBPII [43]), pig CRBPII (PigCRBPII; P50121),...
- 8
- 368
- 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot
... 5¢-GGTGTAGAATTCAAGAACGAGGAACTGCG-3¢ was combined with (a) 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for ... 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1– 220HIS (underlined EcoRI and NotI) ... ATTCCGGAACCAGGAGGAGCGC-3¢ was used in all cases, together with the reverse primer (a) 5¢-ATA GTTTAGCGGCCGCTTACTTGCGCTGGATGATGAG CAGG-3¢ for c1 –218, (b) 5¢-ATAGTTTAGCGGCCGC TTAGTGATGGTGATGGTGATGCTTGCGCTGGATG...
- 12
- 394
- 0
Báo cáo khóa học: High level cell-free expression and specific labeling of integral membrane proteins doc
... agc gat aaa gtg ctc aat ttg cgg aag ctt tta ttc ttt gtc ctc tgc ttt cat taa aac cgg cat atg aca ccg acc ctt tta agt gct ttt tgg cgg aag ctt tta ata gaa aat gcg tac cgc gca ata gac cgg gct agc ... SugE-lowNh cgg cat atg tcc tgg att atc tta gtt att gc gga aag ctt tta gtg agt gct gag ttt cag acc cgg cat atg aac cct tat att tat ctt ggt ggt gc cgg aag ctt tta atg tgg tgt gct tcg tga c cgg cat atg cag ... gct agc aac cct tat att tat ctt ggt gg cgg gct agc atg tgg tgt gct tcg tga c cgg gct agc tcc tgg att atc tta gtt att gc gga gct agc gtg agt gct gag ttt cag acc T7-RNA polymerase E coli tRNAb...
- 13
- 318
- 0
Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc
... 28 NS4B Core 20 20 Figure Construction and characterization of the recombinant VT7-HCV7.9 virus Construction and characterization of the recombinant VT7-HCV7.9 virus A: Generation of recombinant ... http://www.virologyj.com/content/2/1/81 Human α-HCV UNINFECTED VT7-HCV7.9-IPTG VT7-HCV7.9+IPTG Figure localization cence microscopy of HCV proteins by immunofluoresCellular Cellular localization of HCV proteins ... vaccinia virus recombinant VT7HCV7.9 and has analyzed protein expression in culture cells AMV has performed confocal microscopy and defined apoptosis in infected cells MAG has performed PKR and...
- 19
- 373
- 0
Báo cáo hóa học: " Hepatitis C virus NS2 and NS3/4A proteins are potent inhibitors of host cell cytokine/chemokine gene expression" potx
... 5'-GTACGGGGATCCTTATCAGCACTCTTCCATCTCATCGAACTCCTG-3', F gene; 5'AAAAAAAAGGATCCACCATGGCACGAATCCTAAACCTCAAAGA-3', 5'-TTTCCCTGGGATCCTTATCACGCCGTCTTCCAGAACCCG-3' (initiation codon underlined) Preparation of other HCV protein expression ... 5'-TGCGGTACCGGCTAAATCGCAACTGCTTCCCCAG-3' (for IFN-λ1 promoter), 5'GCAACGCGTCATATTCCTGAGTCCTTCCTTGC-3' and 5'CCCGGTACCGTCTGTGTCACAGAGAGAAAGGGAG-3' (for IFN-λ3 promoter), 5'-ATGACGCGTGAAATTCAGGAGTAATCAGATC-3' ... pcDNA3.1(+)-FLAGtagged expression vector [43] Primers for NS3/4A; 5'AAGGGGGGATCCACCATGGCGCCCATCACGGCG- http://www.virologyj.com/content/3/1/66 TACGCCCAGCAG-3', 5'-GTACGGGGATCCTTATCAGCACTCTTCCATCTCATCGAACTCCTG-3',...
- 13
- 475
- 1
báo cáo hóa học:" Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" docx
... 28 NS4B Core 20 20 Figure Construction and characterization of the recombinant VT7-HCV7.9 virus Construction and characterization of the recombinant VT7-HCV7.9 virus A: Generation of recombinant ... http://www.virologyj.com/content/2/1/81 Human α-HCV UNINFECTED VT7-HCV7.9-IPTG VT7-HCV7.9+IPTG Figure localization cence microscopy of HCV proteins by immunofluoresCellular Cellular localization of HCV proteins ... vaccinia virus recombinant VT7HCV7.9 and has analyzed protein expression in culture cells AMV has performed confocal microscopy and defined apoptosis in infected cells MAG has performed PKR and...
- 19
- 389
- 0
Báo cáo y học: "Expression and function of junctional adhesion molecule-C in human and experimental arthritis" pot
... 5'-AGT GCG GAT GTA GTT AAC TCC-3' (GenBank accession number: NM032801), and β-actin forward primer 5'-CCAAGGCCAACCGCGAGAAGATGAC-3' and β-actin reverse primer 5'-AGGGTACATGGTGGTGCCGCCAGAC-3' (GenBank ... GGG GC-3' and murine Jam -C reverse primer 5'-GAC AGG GGT CAC TGG CTT C- 3' (GenBank accession number: NM023844), human JAM -C forward primer 5'-CTG GGG AAG ACA TCC CTG AAG-3' and human JAM -C reverse ... JAM -C and 30 cycles for β-actin) was performed using Taq DNA polymerase (Qiagen AG, Hombrechtikon, Switzerland) and the following primers: murine Jam -C forward primer 5'-TGC TGC TGC TCT TCA GGG GC-3'...
- 12
- 365
- 0
Anxiety- and depressive-like responses and c-fos activity in preproenkephalin knockout mice: Oversensitivity hypothesis of enkephalin deficit-induced posttraumatic stress disorder ppt
... reach a significance difference between WT and ppENK mice: nucleus of ventral orbital cortex (VO), prelimbic and infralimbic cortex (PrL & IL), nucleus accumbens (AC), paraventricular thalamic ... no competing interests Authors' contributions JCK, TCC, BCS, SH, and ACWH contributed to the design and conduct of the study, conducted the statistical analyses, drafted the manuscript and critically ... at 22 C, and mice were given ad libitum access to food and water All experiments were performed in compliance with the Animal Scientific Procedures Act of 1986 and received local ethics committee...
- 14
- 203
- 0
Curcumin modulates dopaminergic receptor, CREB and phospholipase c gene expression in the cerebral cortex and cerebellum of streptozotocin induced diabetic rats potx
... role of curcumin in regularising the altered dopaminergic and second messenger expression in the cerebral cortex and cerebellum of STZ-induced diabetic rats Diabetic encephalopathy, characterized ... insulin and curcumin treatment to STZ-induced diabetic rats can have beneficial effects in reducing blood glucose levels to near control The central complications of hyperglycemia also include ... Unit, Centre for Neuroscience, Cochin University of Science and Technology, Cochin- 682 022, Kerala, India Received: 13 February 2010 Accepted: 31 May 2010 Published: 31 May 2010 © 2010 Kumar Access...
- 11
- 413
- 0
báo cáo khoa học: "The expression and role of protein kinase C (PKC) epsilon in clear cell renal cell carcinoma" ppt
... radical nephrectomy or partial resection Of the 128 RCC samples, 10 were papillary RCC, 10 were chromophobe RCC, and 108 were clear cell RCC according to the 2002 AJCC/UICC classification The clear ... & Clinical Cancer Research 2011, 30:88 http://www.jeccr.com/content/30/1/88 crucial for survival of clear cell RCC cells and may serve as a therapeutic target of RCC Methods Samples We collected ... PKCε expression Cell culture Five human RCC cell lines 769P, 786-O, OS-RC-2, SN1 2C, and SKRC39 were used in this research Clear cell RCC cell lines 769P and 786-O were purchased from the American...
- 9
- 308
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25