c computation and display of parzen window estimates
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc ... cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058 B -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC...
- 11
- 527
- 0
Báo cáo khoa học: The soluble form of the membrane-bound transferrin homologue, melanotransferrin, inefficiently donates iron to cells via nonspecific internalization and degradation of the protein pdf
... Scholarship (to M.F.) from the Natural Sciences and Engineering Research Council of Canada (NSERC) and by fellowship and grant support from the National Health and Medical Research Council of ... the means of two determinations Uptake of 59Fe from sMTf and Tf as a function of ligand concentration The uptake of 59Fe from Tf and sMTf was also investigated as a function of ligand concentration ... internalization of 125I-sMTf cannot be inhibited by an excess of nonradioactive 56Fe-Tf Indeed, a nonspeci c process such as pinocytosis has a large capacity for ligand uptake and will not be...
- 11
- 373
- 0
hoppensteadt f.c. analysis and simulations of chaotic systems
... explosive chain-branched reaction, and another model describes the motion of pendulums, the dynamics of cryogenic electronic devices, and the dynamics of muscle contractions during childbirth Ordinary ... electrical circuits composed of resistors, inductors, and capacitors Figure 1.2 shows an RLC circuit, in which Vin , R, L, and C are given, and the unknowns are the output voltage (V ) and the current ... ergodic theories for dynamical systems and random processes, and Poincar´ had a clear image of the chaotic behavior e of dynamical systems that occurs when stable and unstable manifolds cross...
- 331
- 377
- 0
Báo cáo hóa học: " Editorial 3DTV: Capture, Transmission, and Display of 3D Video" pptx
... requirements of typical 3D services and system architectures are also introduced These solutions focus on two aspects: features to facilitate storage and transport of MVC bitstreams and features to achieve ... entitled “Basic holographic characteristics of a panchromatic light sensitive material for reflective auto stereoscopic 3D display by Ts Petrova et al The aim of this work is to present recently obtained ... standard for 3D video services” by Y Chen et al This paper elaborates the key aspects of system, transport interface, and decoder design of multiview video coding (MVC) approach Techniques needed to...
- 2
- 224
- 0
RELATIONAL MANAGEMENT and DISPLAY of SITE ENVIRONMENTAL DATA - PART 1 pps
... activities; correspondence; drawings; and document management, control, and change tracking © 2002 by CRC Press LLC REFERENCE DATA Often it is desirable to provide access to technical reference ... DIAGRAMS, AND 3-D DISPLAYS Lithologic and wireline logs Cross sections Profiles Fence diagrams and stick displays Block Diagrams and 3-D displays CHAPTER 22 - MAPPING AND GIS Mapping concepts Mapping ... 2002 by CRC Press LLC AUTHOR David W Rich is founder and president of Geotech Computer Systems, Inc in Englewood, CO Geotech provides off-the-shelf and custom software and consulting services for...
- 52
- 375
- 0
RELATIONAL MANAGEMENT and DISPLAY of SITE ENVIRONMENTAL DATA - PART 2 pdf
... issues One or more consultants, labeled C1 , C2 , etc., manage each site, and each consultant may manage the project from various offices, such as C2 A, C2 B, etc Each consultant office might use a different ... properly documented and migrated from the LDC Both LDC and STORET contain raw biological, chemical, and physical data for surface and groundwater collected by federal, state, and local agencies, Indian ... Fmt1 Fmt2 Selection Scr Access Queries / Modules Access Attachments Selection Screen Access Queries / Modules Access Attachments Security System Read/Write Security System Read Only Client Server...
- 65
- 405
- 0
RELATIONAL MANAGEMENT and DISPLAY of SITE ENVIRONMENTAL DATA - PART 3 potx
... (FID) and thermal conductivity detectors (TCD) Other detectors are specific to certain analytes Electron capture detectors (ECD) and Hall electrolyte conductivity detectors (HECD) are specific to ... completion – A construction completion list (CCL) helps identify successful completion of cleanup activities Sites qualify for construction completion when any physical construction is complete (whether ... Response, Compensation, and Liability Act of 1980 (CERCLA, Superfund) – Enacted to clean up abandoned and inactive hazardous waste sites Creates a tax on the manufacture of certain chemicals to create...
- 32
- 373
- 0
RELATIONAL MANAGEMENT and DISPLAY of SITE ENVIRONMENTAL DATA - PART 4 pptx
... Reference standard Measurement standard QC scope Analytical batch Analytical batch Analytical batch Analytical batch Analytical batch Analytical batch Analytical batch Analytical batch Analytical ... CRC Press LLC If the outcome of a test is likely to change, conduct the test only once Rich (1996) Calibration Verification or CCV, and CCV samples are run at a project-specific frequency such ... Imprecise Accurate and Imprecise Inaccurate and Precise Accurate and Precise Figure 76 - Illustration of precision vs accuracy PROTECTION FROM LOSS The final quality assurance component is protection...
- 53
- 299
- 0
RELATIONAL MANAGEMENT and DISPLAY of SITE ENVIRONMENTAL DATA - PART 5 ppsx
... unbiased, which can be of value in many situations Finally, computerized mapping can greatly improve the ease and accuracy of volumetric calculations © 2002 by CRC Press LLC Often the decision on ... number of factors, such as the isotopic mix, physical properties of the sample, and so on, and consequently is at best site-specific, and at worst involves complicated statistical calculations ... displays Graph displays are described in Chapter 20 Cross sections are discussed in Chapter 21, and maps and GIS displays in Chapter 22 Chapter 23 covers statistical analysis and display, and using...
- 82
- 311
- 0
RELATIONAL MANAGEMENT and DISPLAY of SITE ENVIRONMENTAL DATA - PART 6 ppsx
... These include reduced overhead costs, increased project efficiency, replacing older systems, reduced project operating costs, and increased revenue Reduced overhead costs Lower costs can be achieved ... by CRC Press LLC Increased efficiency One of the most obvious areas of financial benefit of an automation project is increased efficiency One Enviro Data user reported that its time to process ... in increased confidence in the data and in the decision-making process for the project The impact of these technical benefits on those outside the project, such as upper management and especially...
- 12
- 262
- 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... Japanese Ministry of Education, Culture, Sports, Science and Technology; the Japan Society for the Promotion of Science; and the Japan Science and Technology Agency References 13 14 15 Pawson ... fluorescence and immunocytochemical staining with anti-Flag or anti-HA sera Cell images were acquired by confocal microscopy (LSM510; Carl Zeiss, Inc., Oberkochen, Germany) Morphometric analysis of ... T, Courtney MJ & Coffey ET (2005) Constitutively active cytoplasmic c- Jun N-terminal kinase is a dominant regulator of dendritic architecture: role of microtubule-associated protein as an effector...
- 11
- 658
- 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... activation of a family of cytosolic cysteine proteases, caspases, which are required for many of the morphological changes that occur during apoptosis The mitochondrial release of cytochrome c ... membranes, which liberates cytochrome c and activates caspase and the apoptosome [23] Transfection of tBid directly triggers mitochondrial-dependent apoptosis and caspase activation [17] Because Itch overexpression ... final concentration of 1% Extracts were incubated for 20 at C and centrifuged at 18 000 g in a microcentrifuge at C For immunoprecipitation assays, extracts of transfected cells were immunprecipitated...
- 12
- 718
- 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... triplicate Subcellular location of STAT1 determined by fluorescence microscopy: (B) cytoplasmic location of STAT1 in untreated cells and nuclear location in IFN -c treated cells (20 ngÆmL)1); (C) cytoplasmic ... STAT3-speci c or could also interact with STAT1 and disrupt its signalling In colorectal carcinoma cells, treatment with IFN -c sensitizes cells to cytotoxic compounds, and can also induce cell death ... cell death of the colon carcinoma SW480 cells To examine the transfection efficiency of hpST3dODN into cells, we applied different concentrations of the fluorescein isothiocyanate (FITC)-labelled...
- 11
- 558
- 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA A The PCR reaction ... add EcoRI and KpnI restriction endonuclease sites to the 5¢ and 3¢ ends, respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT ... CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C The PCR reaction was done as described above The amplified PCR product was inserted into the EcoRI and KpnI sites of...
- 14
- 650
- 0
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx
... CP-MAS 1 3C- NMR chemical shift values of ring and methyl carbons of native chitosan, LMWC and chito-oligomers Chemical shift values (p.p.m.) Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers ... standards Circular Dichroism (CD) CD spectra for native chitosan and LMWC (5 mgÆmL)1 in 0.1 M perchloric acid; path length, cm) were recorded on a Jasco J-810 automatic recording spectropolarimeter, continuously ... sequence in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the first is the major type and the last one results from the heterogeneous de-Nacetylation...
- 11
- 673
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...
- 15
- 597
- 0
![Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc](https://media.store123doc.com/images/document/14/br/vp/small_vpv1392870032.jpg)
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... Pyrrol[1,4]benzodiazepine antibiotics Proposed structures and characteristics of the in vitro deoxyribonucleic acid adducts of anthramycin, tomaymycin, sibiromycin, neothramycins A and B Biochemistry 20, 1111–1119 ... DNA and high micromolar concentrations of mitoDC-81 are sufficient to alkylate linear, circular and supercoiled DNA As these concentrations of mitoDC-81 are easily achieved within the mitochondrial ... mitochondria or cells The reasons for the lack of alkylation of mtDNA within mitochondria by mitoDC-81 are unclear The local concentrations of mitoDC-81 and DNA, and the duration of the experiments...
- 10
- 638
- 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... nuclear genome coded isoforms of CytOX V [10,32] The regulation of genes CytOX5a and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and ... iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed under hypoxic (O2 < 0.5 lM) and heme ... the catalytic activity of the enzyme by affecting its stability or composition Although succinylacetone and CoCl2 are known inhibitors of heme biosynthesis, these agents also elicit nonspeci c and...
- 9
- 554
- 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... sequencing, the oligonucleotide ccNiR_GTPRNGPW, 5¢-GGIACICCIMGIAAYG GICCITGG-3¢, was synthesized and used together with the primer ccNiR_Cterm, 5¢-TCYTGICCYTCCCASACYT GYTC-3¢, already used in nrfA ... Structural and functional approach toward a classification of the complex cytochrome c system found in sulfate-reducing bacteria Biochim Biophys Acta 1058, 61–66 Ó FEBS 2003 Characterization of ccNiR...
- 12
- 593
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... affinity of the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and, 8,9-di-O-acetylneuraminic acid [6] and ... EDTA, and mL fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions ... was helpful in deducing the binding specificity of the lectin Fucose and lactose inhibited HA activity of purified lectin Sucrose, glucose and glucose-6-phosphate inhibit at concentrations less than...
- 8
- 616
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008