c c bond formation between two alcohols

Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1

... (in most of cases containing a main group metal atom) with an organic electrophile in the presence of groups 8–10 metal catalysts to achieve a C C, C H, C N, C O, C S, C P, or C M bond formation ... Scheme 1-8 α-Alkylation of ketones by an oxidation/aldol/reduction sequence Scheme 1-9 Borrowing hydrogen in the β-functionalisation of alcohols Scheme 1-10 C- C bond formation between two alcohols ... reactions The application of copper-group based heterogeneous catalysts in fine chemicals synthesis can be generally divided into: catalytic oxidation, catalytic hydrogenation and catalytic C- C...

221
658
0

Báo cáo khoa học: " Effect of the medical emergency team on long-term mortality following major surgery"

Danh mục: Y học thưởng thức

... Critical Care Vol 10 No Maegele et al Teicoplanin Vancomycin Rifampicin Erythromycin Fosfomycin Clindamycin Ofloxacin Ciprofloxacin Amikacin Gentamicin Tobramycin Meropenem Imipenem Cefepim Ceftazidim ... therapy Clindamycin has been shown to have good activity against staphylococci and streptococci, as well as anaerobic species, that is, Bacteroides species, Corynebacteria, and Mycoplasma [48] Psychoemotional ... ACCP/SCCM Consensus Conference Committee American College of Chest Physicians/Society of Critical Care Medicine Chest 1992, 101:1644-1655 Fleischmann W, Lang E, Russ M: Infektbehandlung durch Vakuumversiegelung...

9
761
0

EFFECT OF THE NUMBER OF THE VERTICAL PIPES FOR THE PASSIVE AERATION ON THE COMPOSTING RATE

Danh mục: Môi trường

... of carbon in the DF [kg] Cf = final carbon content after the composting process [kg] -1 -1 C p = heat specific coefficient [kcal･kg ･ C ] h = overall heat transfer coefficient [kcal･m-2･hr-1･ C- 1] ... process 6 7 Electric heater Temperature recorder Reactor Thermocouple CO2 meter Gas holder Composting mass Perforated pipes Fresh Air by the natural convection Fig Schematic diagram of the composting ... researchers when forced aerations modes were used (Nakasaki et al., 1998a and 1998b) ζ = Co − C f Co (1) where ζ, Co and Cf are , respectively, the conversion of carbon, the initial carbon content...

8
622
1

Effect of the presence of coexisting substances on UV inactivation of Cryptosporidium parvum oocysts

Danh mục: Môi trường

... DISCUSSION Effects of various substances on UV inactivation of C parvum oocysts If it is assumed that the UV intensity in a C parvum oocyst suspension containing turbid substances decreases according ... preincubation, oocysts were incubated in excystation medium containing 1.5% (w/v) taurocholic acid and 0.5% (w/v) trypsin at 37 oC for 60 minutes The numbers of intact oocysts (IO) before excystation ... irradiation efficacy caused by the presence of turbid substances in water (Hirata et al., 2002) In particular, substances that tend to adhere to the surface of C parvum oocysts may reduce the effectiveness...

8
358
0

Tài liệu Báo cáo "Effect of the preparation conditions on the properties of Fe-Pt nanoparticles produced by sonoelectrodeposition " pptx

Danh mục: Báo cáo khoa học

... did not change significantly with ton This is because with J = 15 mA/cm2, the chemical composition of nanoparticles are close to the equiatomic composition The atomic percent of Fe increased ... and around the collapsing bubble [14] Sonoelectrochemistry has the potential benefit of combining sonochemistry with electrochemistry Some of these beneficial effects include acceleration of mass ... sonoelectrochemical device employed is similar to that described in ref [16] A titanium horn with diameter of 1.3 cm acted as both the cathode and ultrasound emitter (Sonics VCX 750) The electroactive...

7
513
0

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Danh mục: Báo cáo khoa học

... the structure of the A state of cytochrome c Biochemistry 39, 12632– 12638 18 Sinibaldi F, Howes BD, Smulevich G, Ciaccio C, Coletta M & Santucci R (2003) Anion concentration modulates conformation ... Hilgen-Willis SE & Garcia LL (1996) Nuclear magnetic resonance studies of class I cytochromes c In Cytochrome C A Multidisciplinary Approach (Scott RA & Mauk AG, eds), pp 203–284 University Science Books, ... (located close or within the C- terminal helix) In the segment, position 88 is occupied by an acidic residue (E88) in yeast cytochrome c and by a basic residue (K88) in horse cytochrome c A recent...

11
487
0

The effect of grammar teaching (syntax) in English on 5 to 16 year olds’ accuracy and quality in written composition potx

Danh mục: Kỹ năng viết tiếng Anh

... following sources: • searching of electronic bibliographic databases: Educational Resources Information Center (ERIC); PsycINFO; and Social Science Citation Index (SSCI) • citations in reference lists ... Education Quality assurance Qualifications and Curriculum Authority (England and Wales) GLOSSARY Accuracy of writing Accuracy in terms of sentence structure and correct use of punctuation with standard ... sentences Significant difference between the control and experimental classes for change in frequency of class errors Significant difference between the control and experimental class for change...

85
700
1

Gaza’s Children: FallinG Behind The eFFeCT oF The BloCkade on Child healTh in Gaza ppt

Danh mục: Sức khỏe trẻ em

... 6736%2809%2960108-2/abstract (last accessed 23 March 2012) 10 These figures are for the years 2007-2011 Additional child deaths occurred indirectly from the conflict or in unclear circumstances OCHA, Protection of Civilians ... (last accessed 23 March 2012) and IRIN, “Cancer care crisis in Gaza”, March 2011, available online at http://www.irinnews org/Report/92143/OPT-Cancer-care-crisis-in-Gaza (last accessed on 23 March ... Strip 125 These figures include the years 2007-2011 Additional child deaths occurred indirectly from the conflict or in unclear circumstances OCHA, Protection of Civilians Casualties Database, available...

32
425
0

Báo cáo Y học: Effect of the disease-causing mutations identiﬁed in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Danh mục: Báo cáo khoa học

... 5¢-ATATGAA TTCTCTCTAAGGAGATATACTTATGACCGTTTCCAA CATTGGG-3¢ for RNH2B-F; 5¢-GGGGAAGCTTCTA GTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAAT CCATC-3¢ for RNH2B-R; 5¢-ATATAAGCTTCTCTCAA GGAGATATACTTATGACCAAAGATGCCGTG-3¢ ... ampliﬁed by PCR using pJAL700K as a template The sequences of the PCR primers are 5¢-ATATTCATATG AAGATAGCGGGCATTGACGAGGC-3¢ for 5¢-primer and 5¢-ATTATAGAATTCTCACTTTTTCTCGCTCTCAA CTTTTTC-3¢ for 3¢-primer, ... [piperazine-1,4-bis(ethanesulfonic acid)] (open circle), and Tris–HCl (ﬁlled circle) (C) Dependence of Sc-RNase H2* activity on salt concentration The enzymatic activity of Sc-RNase H2* was determined in the presence of...

14
482
0

the effect of the hydrothermal treatment with aqueous naoh solution on the photocatalytic and photoelectrochemical propertiesof visible light-responsive TiO2thin ﬁlms

Danh mục: Vật lý

... three-electrode cell that consists of the film electrode, a Pt electrode and a saturated calomel electrode (SCE) as the working, counter and reference electrodes, respectively The working electrode ... Shimadzu) The chemical composition of the thin films were investigated by X-ray photoelectron spectroscopy (XPS, ESCA-3200, Shimadzu) The photoelectrochemical properties of the film electrodes (Vis-TiO2/Ti ... 160 M Matsuoka et al / Catalysis Today 132 (2008) 159–164 photocatalytic performances through the chemical surface modification Special attentions will be focused on the effect of the hydrothermal...

6
489
0

effect of the market on construction of music manufactured b

Danh mục: Kỹ năng viết tiếng Anh

... millions of records, they did not compromise their music to so The third group are one hundred percent commercially based Any music made by a band in this category is produced for a pre-specified area ... product is tailored according to what the mass audience wants, therefore any aspect of art is compromised Case Study - Upside Down Upside Down fit perfectly into the third category in Hirschman's ... unique piece of work, through to cultural production on a mass scale.As I described above, in the context of peer-orientated creativity, Led Zeppelin became a big-selling band, but did not compromise...

4
338
0

Gaza’s Children: FallinG Behind - The eFFeCT oF The BloCkade on Child health in Gaza ppt

Danh mục: Sức khỏe trẻ em

... 6736%2809%2960108-2/abstract (last accessed 23 March 2012) 10 These figures are for the years 2007-2011 Additional child deaths occurred indirectly from the conflict or in unclear circumstances OCHA, Protection of Civilians ... (last accessed 23 March 2012) and IRIN, “Cancer care crisis in Gaza”, March 2011, available online at http://www.irinnews org/Report/92143/OPT-Cancer-care-crisis-in-Gaza (last accessed on 23 March ... Strip 125 These figures include the years 2007-2011 Additional child deaths occurred indirectly from the conflict or in unclear circumstances OCHA, Protection of Civilians Casualties Database, available...

32
453
0

The Effect of the 2001 Tax Cut on Low- and Middle-Income Families and Children pdf

Danh mục: Ngân hàng - Tín dụng

... level—benefit from tax credits such as the child tax credit (CTC) and the child and dependent care tax credit (CDCTC) The $500 per child tax credit exempted another $3,333 per child from tax.2 For ... The Tax Policy Center (TPC) aims to clarify and analyze the nation’s tax policy choices by providing timely and accessible facts, analyses, and commentary to policymakers, journalists, citizens ... theoretical since few families with such low incomes would owe income tax, even without the CDCTC Note that the EITC did not affect the tax-free level of income for a family with the maximum child care...

49
425
0

Báo cáo khoa học: Effect of mutations at Glu160 and Val198 on the thermostability of lactate oxidase doc

Danh mục: Báo cáo khoa học

... Quick Change Site-Directed Mutagenesis Kit (Stratagene) According to the kit protocol, the plasmid containing the mutant lactate oxidase gene was ampliﬁed by PCR with 125 ng of each mutagenic ... following conditions: after heat denaturation at 95 C for 30 s, we applied 16 treatment cycles, each consisting of 30 s at 95 C, at 55 C, and 12 at 68 C The ampliﬁed plasmids were cooled on ice ... software (Version 4.3, Accelrys Inc.) on an ONYX2 workstation (Silicon Graphics, Inc.) Fig Variation of the atomic temperature factors averaged for the main-chain atoms of spinach glycolate oxidase [19]...

6
512
0

Báo cáo khoa học: Analysis of the effect of potato carboxypeptidase inhibitor pro-sequence on the folding of the mature protein pot

Danh mục: Báo cáo khoa học

... RP-HPLC, on a protein C4 0.46 · 25 cm, lm column (Vydac) The conditions used were: solvent A was water containing 0.1% triﬂuoroacetic acid, solvent B was acetonitrile containing 0.1% triﬂuoroacetic ... ProNtPCI by means of one-step PCR and cloned into pBAT4 vector without the leader sequence OmpA All constructs cloned into pINIII vector were transformed into Escherichia coli strain MC1061 and ... differences Such differences could arise from changes in the structure of the PCI core and/or from the additional structure adopted by the pro-region and its interactions with the PCI core Discussion...

10
458
0

Báo cáo khoa học: Effect of the -Gly-3(S)-hydroxyprolyl-4(R)-hydroxyprolyltripeptide unit on the stability of collagen model peptides ppt

Danh mục: Báo cáo khoa học

... steric clashes [31] 3-hydroxyproline in the collagen triple helix 80 C C Fig CD spectra of acetyl-(Gly-3(S)Hyp-4(R)Hyp)10-NH2 CD spectra were measured at 4, 20, 40 and 80 C in water at a concentration ... Fmoc-amino acids Fmoc-Gly-OH and Fmoc-Pro-OH were purchased from Applied Biosystems, Fmoc-4(R) Hyp(tBu)-OH was purchased from Novabiochem (EMD Biosciences Inc., San Diego, CA, USA), and acetyl glycine ... rectangular quartz cell (Starna Cells Inc., Atascadero, CA, USA) Peptide concentrations were determined by amino acid analysis (L-8800A amino acid analyzer; Hitachi High Technologies America...

11
601
0

Báo cáo hóa học: " Effect of triplet multiple quantum well structures on the performance of blue phosphorescent organic light emitting diodes" potx

Danh mục: Hóa học - Dầu khí

... reference device; device B, n consists of [FIrpic doped in mCP (12.5 nm)]n = and [CCL (mCP/TPBi = 1:1, nm)]n = 1; device C, n consists of [FIrpic doped in mCP (6.6 nm)]n = and [CCL (mCP/TPBi ... bis[(4,6-difluorophenyl)-pyridinato-N ,C2 ′]picolinate [FIrpic] doped in N,N′-dicarbazolyl-3,5-benzene [mCP] with charge control layers [CCLs] as an MQW structure The device architecture was developed to confine excitons inside each ... efficiency, external quantum efficiency, power efficiency, and current density characteristics were measured and immediately recorded with a Chroma meter CS-1000A (Konica Minolta Holdings, Inc., Chiyoda,...

12
417
0

báo cáo hóa học: " Imaging the effect of receptor for advanced glycation endproducts on angiogenic response to hindlimb ischemia in diabetes" docx

Danh mục: Hóa học - Dầu khí

... Tc-HYNIC-RGD in the ischemic hindlimbs may have been overestimated in the diabetic mice Nevertheless, the diabetic mice had significantly lower uptake of 99m Tc-HYNIC-RGD in the ischemic limb compared ... Wautier JL, Lévy BI: Blockade of advanced glycation endproduct formation restores ischemia-induced angiogenesis in diabetic mice Proc Natl Acad Sci 2003, 100:8555-8560 Tchaikovski V, Olieslagers ... ischemia is ameliorated both in diabetic and non-diabetic mice Diabetics have an attenuated angiogenic response to tissue hypoxia which contributes to long-term complications including poor collateral...

9
398
0

Báo cáo hóa học: "Effect of the carbon nanotube surface characteristics on the conductivity and dielectric constant of carbon nanotube/poly(vinylidene fluoride) composites" doc

Danh mục: Hóa học - Dầu khí

... ratio CO/CO2 and the lowest value of pHPZC, indicating that this is the most acidic sample CNTox900 presents the highest CO/CO2 ratio, suggesting the less-acidic characteristics, which matches ... Nanotechnology 2009, 20:035703 doi:10.1186/1556-276X-6-302 Cite this article as: Carabineiro et al.: Effect of the carbon nanotube surface characteristics on the conductivity and dielectric constant ... dielectric response In a previous study [19], it was demonstrated that an increase in the dielectric constant is related with the formation of a capacitor network Conclusions The effect of surface...

5
353
0

Báo cáo hóa học: " Effect of the Nd content on the structural and photoluminescence properties of silicon-rich silicon dioxide thin film" pdf

Danh mục: Hóa học - Dầu khí

... nanocrystals and the occurrence of disorder in the host matrix The former participates in the concentration quenching mechanism because of cross relaxation processes, while the latter induces ... Pitt CW: Optical properties of PECVD erbium-doped silicon-rich silica: evidence for energy transfer between silicon microcIusters and erbium ions J Phys Condens Matter 1994, 6:L319 Franzo G, Iacona ... thin films and carried out the optical and microstructural characterizations XP investigated the films by HRTEM JC made significant contribution to the optical properties FG conceived of the study...

8
474
0