c ade was mediated by cr2 with increased attachment to the target cell the primary mechanism
Báo cáo y học: " Intermolecular masking of the HIV-1 Rev NLS by the cellular protein HIC: Novel insights into the regulation of Rev nuclear impo" doc
Ngày tải lên :
13/08/2014, 01:20
... obstruction of the NPC since M9 or Rev nuclear import mediated by transportin remained unaffected by HIC The molecular recognition of NLSs by import receptors in the cytoplasm determines their nuclear ... column) In contrast, when Rev was co-expressed with HIC or HIC (144-246) containing the I-mfa domain, both colocalised in the cytoplasm and the percentage of cells displaying Rev in the nucleus was ... performed colocalisation studies in COS7 cells transfected with HIC, its mutants and Rev The localization of HIC and the mutant, HIC (2-144) was primarily cytoplasmic, although they could be detected...
- 13
- 282
- 0
Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt
Ngày tải lên :
17/03/2014, 03:20
... harvested by centrifugation, then washed twice with phosphate buffered saline (NaCl/Pi) and once with hypotonic buffer The cells were resuspended in hypotonic buffer, incubated for 10 on ice, and ... 1B, columns 1–7) The replication activity of JCV TAg in mouse cell extracts is not dependent on the sequence of the plasmid as the incorporation of radioactive dNMPs was the same whether the ... proliferating cell nuclear antigen (PCNA), replication factor C (RF -C) , topoisomerase I and DNA ligase are not responsible for JCV species specificity in vitro Our murine FM3A cell extracts contain...
- 8
- 326
- 0
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt
Ngày tải lên :
18/03/2014, 01:20
... total RNA was extracted with TRIzol reagent (Life Technologies) according to the manufacturer’s protocol Total RNA concentration was determined by UV absorbance at 260 nm For each sample lg total ... the absence (control) or presence of 100 lM calcium and 110 nM CaM The reaction was started by the addition of 100 lM [c- 32P]ATP (Amersham Biosciences Corp.) to the reaction mix in a total volume ... primer: 5¢-GAACCA CCGATCCAGACACT-3¢) as a control Reactions with no DNA added served as a negative control The PCR cycling profile was: denaturation at 92 C for 30 s, annealing at 58 C for and extension...
- 12
- 365
- 0
Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx
Ngày tải lên :
23/03/2014, 11:20
... GCTGTTCTCAGCCTCACT TCCGGCTGGTAAATGCGC AATTGCGGCCGCAGAACCTCGCAAGGCCCCCAGCCTGCCGCAAGCTGCTAGCGCGTGCACGTCGACGAATTCAATT AATTGAATTCGTCGACGTGCACGCGCTAGCAGCTTGCGGCAGGCTGGGGGCCTTGCGAGGTTCTGCGGCCGCAATT GACGCACGTCAATTGGCCGCTGGATGGGGCCCCTGTGAAGTGTTGCTGAGCAACGCGCTGGCGCG ... GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGAC GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTGTACCGACCTCCGCCAA CAGCAGAATGGTTTCACG CAGAAGCTCATCCGGCTG AGCATCACGACGCCGTCA GCTGTTCTCAGCCTCACT ... AATTGCGGCCGCCCGCAAGCTGGCGCGCGTAGTCGTTGGCCACGTCTAGACGGGGCACGTCGACGAAATCAATT AATTGAATTCGTCGACGTGCCCCGTCTAGACGTGGCCAACGACTACGCGCGCCAGCTTGCGGGCGGCCGCAATT GACGCACGTCGCAAATGATTATGCCAGGCAATTGGCCGCCGGGTGGGGGCCTTGCGAGGTTCTTCT...
- 12
- 334
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
Ngày tải lên :
22/02/2014, 04:20
... a cell scraper Buffer (2% SDS, 20% glycerol, 50 mM Tris/ HCl, pH 6.8) to dissolve cells was added to the cells, and then the cell suspension was sonicated in a bath-type sonicator for 5min The ... PKC Recently, Neuzil et al reported the opposite findings to ours They proposed that TS-induced apoptosis in hepatopoietic and cancer cell lines is caused by the prevention of PKC activity due to ... a CO2incubator at 37 C with CO2 in humidified air Then, the medium containing serum was removed, and the cells were washed with phosphate buffered saline Next, mL of the medium containing TS without...
- 6
- 494
- 0
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx
Ngày tải lên :
07/03/2014, 05:20
... translation with the concomitant promotion of the translation of speci c mRNAs This is well illustrated by the increased translation of the activating transcription factor (ATF4), a transcription factor ... response to GCN2 activation We next used yeast cells to further confirm the inability of Nck-1 to modulate eIF2aSer51 phosphorylation mediated by GCN2 Gcn2p is the sole eIF2akinase present in Saccharomyces ... perhaps the stress produced by the deprivation of four amino acids was too strong to be attenuated by Nck-1 To address this point, we subjected the cells to only single amino acid starvation (leucine),...
- 11
- 376
- 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
Ngày tải lên :
31/03/2014, 08:20
... mesenteroides Leuconostoc mesenteroides Streptococcus mutans Leuconostoc mesenteroides Neisseria polysaccharea Thermotoga maritima Thermus aquaticus Chlamydia trachomatis Synechocystis sp Potato Arabidopsis ... Thermoanaerobacter ethanolicus Escherichia coli Bacillus cereus S cerevisiae (MAL3S) Desulfurococcus mucosus Sulfolobus acidocaldarius Pseudomonas amyloderamosa Bacillus circulans Leuconostoc mesenteroides ... GAA TTC C ATG GGG AAG AAC GGC AGC-3Â (pos 87114, sense orientation), and B; 5Â-TTT GGT ACC TCA GTT CTT CTC CCA GAC GGC GTA-3Â (pos 13951363, antisense orientation), to generate DNA with the EcoRI...
- 14
- 557
- 0
Báo cáo hóa học: " Supporting QoS in MANET by a Fuzzy Priority Scheduler and Performance Analysis with Multicast Routing Protocols" docx
Ngày tải lên :
23/06/2014, 00:20
... metrics can be combined into a single decision so as to find the crisp value of the priority of packets Our solution to determine the priority index of the packets utilizes the fuzzy logic concept ... immediately, which in turn increases the PDR For ODMRP, the PDR characteristics with FPS are closer to those without FPS Again in CAMP, the PDR improves by 5% due to the proper selection of the priority ... and scheduling of data packets based on priority index set by FPS NTPMR, the increased delay was the main constraint, which is overcome by the inclusion of the novel fuzzy scheduler The scheduler,...
- 11
- 362
- 0
The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf
Ngày tải lên :
28/06/2014, 19:20
... units column of the new balance The from the 15 is carried and added to the tens column of the checks drawn, which makes 21, and the of the latter is subtracted from the in the tens column of the ... so on to the top of the column; the last sum is either mentally noted, or it can be written down and then added to the tens as indicated by the periods, when the total will be the sum of the single ... and add it to the tens column of the deposits Then carry the tens figure of the unit column of the checks drawn, which is 1, and add it to the tens column of the deposits and subtract as before,...
- 95
- 383
- 0
Ultrasonography in In Vitro FertilizationRoger A. PiersonDepartment of Obstetrics, Gynecology pptx
Ngày tải lên :
05/08/2014, 16:20
... reportedly occurs in 1–7% of cycles the so-called ‘‘empty follicle syndrome.’’ The etiology appears to be multifactorial and may involve both technical and biological mechanisms (49,66) The complication ... can be observed directly as it is maneuvered within the ovaries and into each follicle The follicular fluid containing the oocyte/cumulus complex is then aspirated by application of gentle suction ... retrospective analysis of case records, approximately 5% of cycles were compromised by the presence of lumen fluid accumulation at some time during the IVF cycle procedures, and in 2% of the cases the...
- 26
- 178
- 0
Báo cáo khoa học: "In vitro studies on the modification of low-dose hyper-radiosensitivity in prostate cancer cells by incubation with genistein and estradiol" pot
Ngày tải lên :
09/08/2014, 09:22
... regard to damage recognition, signal transduction and damage repair [39] Amongst others they postulate a rapidly occurring dose-dependent premitotic cell cycle checkpoint that is specific to cells ... explained by the results of cell cycle analysis In PC-3 cells, incubation with estradiol 10 μM or genistein 10 μM did not alter cell cycle distribution significantly when compared to controls ... radiation-induced activation of NF-kappaB in prostate cancer cells promoting apoptosis and G2/M cell cycle arrest BMC Cancer 2006, 6:107-117 Dewey WC, Ling CC, Meyn RE: Radiation-induced apoptosis:...
- 12
- 368
- 0
Báo cáo y học: "Discovering and validating unknown phosphosites from p38 and HuR protein kinases in vitro by Phosphoproteomic and Bioinformatic tools" doc
Ngày tải lên :
10/08/2014, 09:22
... leaking The TiO2 microcolumn was packed by the application of air pressure Buffers used for loading or washing of the microcolumn contained 80% acetonitrile to prevent non-specific binding to the C8 ... used to pack the beads to obtain R3 microcolumns of mm Each acidified sample was loaded onto a R3 microcolumn The R3 microcolumns were subsequently washed with 30 μl of 0.1% TFA, and the phosphopeptides ... phosphopeptides) [Mascot searches (http://proteomicsresource washington.edu/mascot/search_form_select.html) were carried out by “in-Mascot-house server of Centro Nacional de Investigaciones Oncológicas CNIO,...
- 16
- 265
- 0
Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot
Ngày tải lên :
12/08/2014, 04:21
... lines Cytopathic Effects (CPE)a Cell line Species/tissue CPXV-NOH1 MVA-HANP Rec1 Rec Rec Rec 3a Rec 3b IEC-6 BHK-21 Caco-2 H411E FHs74int Hutu-80 Vero RK-13 CHO-K1 A549 PK15 NMULI HEK-293 (CRL-1573) ... Localization of the transgenic protein We used immunogold cryo electron microscopy to track the localization of influenza virus HA protein produced by transgenic poxviruses in infected cells The cellular ... of the genetic locus at which the HA was inserted and the host cell responses to the HA protein are some of the factors that might affect the stability of the HA transgene or the loss of the...
- 13
- 377
- 0
Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps
Ngày tải lên :
12/08/2014, 04:21
... lines Cytopathic Effects (CPE)a Cell line Species/tissue CPXV-NOH1 MVA-HANP Rec1 Rec Rec Rec 3a Rec 3b IEC-6 BHK-21 Caco-2 H411E FHs74int Hutu-80 Vero RK-13 CHO-K1 A549 PK15 NMULI HEK-293 (CRL-1573) ... Localization of the transgenic protein We used immunogold cryo electron microscopy to track the localization of influenza virus HA protein produced by transgenic poxviruses in infected cells The cellular ... of the genetic locus at which the HA was inserted and the host cell responses to the HA protein are some of the factors that might affect the stability of the HA transgene or the loss of the...
- 13
- 294
- 0
Báo cáo y học: "Distribution of airway narrowing responses across generations and at branching points, assessed in vitro by anatomical optical coherence tomography" docx
Ngày tải lên :
12/08/2014, 14:20
... minutes after carbachol, which approximated the time course of bronchoconstriction (see Results) The rate of pullback was 0.19 mm/sec In the second protocol, carbachol was applied to the lumen (inside) ... daughter bronchus, it was necessary to take into consideration the angle of pitch at which the daughter bronchus branched from the parent This was achieved by constructing a 3D profile of the airway ... http://respiratory-research.com/content/11/1/9 Page of 12 Figure A 3D profile of a porcine bronchial tree acquired by anatomical optical coherence tomography (aOCT) The major portion of the bronchial...
- 12
- 297
- 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
Ngày tải lên :
13/04/2013, 10:29
... compete with other competitors in the AVS and electric wires and cables markets • The Company also has a highly centralized decision-making structure Most decisions are made by the director of the Company ... from the lower employees thereby reducing the Company’s creativity • The capability to manage a number of retailers is limited 3.2.4 Company Structure Director Director Director Assistant Director ... illustrate alternative current (AC) The circle, together with the LiOA name put in the center of the circle, means using LiOA gives you stable AC Under the circle is the name LiOA as the best solution...
- 67
- 974
- 0
Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx
Ngày tải lên :
20/02/2014, 05:20
... 0.05) to compare the predictions made in each case to the actual pleasantness scores provided by Whissell’s dictionary, and thereby assess the quality of the knowledge used to make the predictions ... properties The phrase “wet haddock” is a readymade for coldness because “wet” accentuates the “cold” that we associate with “haddock” (via the web simile “as cold as a haddock”) In the words of ... returns to the investor The realm in 15 which a maker of linguistic readymades operates is not the real world, and not an abstract conceptual space, but the realm of texts: large corpora become rich...
- 6
- 442
- 0
Tài liệu In Rare Form A Pictorial History of Baseball Evangelist Billy Sunday pptx
Ngày tải lên :
21/02/2014, 06:20
... bonds Neither handmade crafts from mother to son nor evidence of lavish gifts of a successful preacher to his elderly mother are to be found in the collection The scarcity of photos of his mother ... performance was impressive enough to capture the attention of baseball legend Adrian “Cap” Anson of the Chicago White Stockings (later renamed the Chicago Cubs) Sunday jumped at the chance to try ... Philadelphia and Cincinnati, offered him lucrative contracts The Philadelphia contract was for $400 a month for three years, while the Cincinnati contract was $500 per month for one year Considering...
- 169
- 398
- 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
Ngày tải lên :
07/03/2014, 06:20
... catalysis These comprise: (a) the concerted polar nucleophilic mechanism; (b) the direct hydride transfer mechanism; and (c) the single electron transfer mechanism Recent support for the concerted ... translation initiation of the inserted gene, using the primer 5¢-CAACTAATTATTCG AAACCATGGATTCACGTGGCCC-3¢ and its reverse complement The modified pPICZA vector was then digested with NcoI and XhoI, and ... dependence of Km with pH is required to indicate the binding of the deprotonated form because the pH dependence of Km or Ks is affected by all macroscopic ionizations occurring in the system [22] The...
- 9
- 327
- 0