... abundance of heparin-like structures on the surface of the vascular bed, and the lack of good estimates of local concentrations of coagulation proteins or reactants during hemostatic reactions, ... Bottom right: molecular surface of FVa domains A1, A2, and A3 color-coded according to electrostatic potentials Preliminary docking of FVa Arg506 into the catalytic cleft of APC suggests that the ... similar inhibitory activity to UFH In contrast, equimolar amounts of pentasaccharide did not influence the inactivation of FVa by APC To relate the inactivation curves of FVa to speci c cleavages in...
... endl; switch (grade) { case 'A' : cout > one; while (one >0) { cout > two; cout ... First step is to decide which of the variables can be selected as loop control variable If no variables are available to select, you can add new variable - for example, a char variable - and...
... incubation Ó FEBS 2002 Tocopheryl succinate-enhanced NO production (Eur J Biochem 269) 2369 Fig Enhancements by TS of LPS/IFN-induced NO production (A) and iNOS induction (B) in VSMC The concentrations ... LPS/IFN-induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives on the enhancement by TS of LPS/IFN-induced NO production We compared the effects of ... N., Mayne, G .C. , Olejnicka, B., Negre-Salvayre, A., Stı´ cha, M., Coffey, R.J & Weber, C (2001) Induction of cancer cell apoptosis by a-tocopheryl succinate: molecular pathways and structural requirements...
... place random numbers from to 52 in it Once we have the random numbers, we just display the card names in that order string cards[52]={ "CA", "C2 ", "C3 ", "C4 ", "C5 ", "C6 ", "C7 ", "C8 ", "C9 ", "C1 0","CJ","CQ","CK", ... data, the second one to find the difference of each score from the mean and the third one to find store the square of deviation of each score The mean is calculated by adding all valid scores stored ... Read scores from a file into an array Keep track of number of scores entered Find difference of each score from the Mean Square the differences and add the squares find stadard deviation create...
... tissue culture process in order to be economically competitive with field cultivation of ginseng A number of physical and chemical factors that could influence secondary metabolite in plant cell cultures ... of the hormone concentration and combination are often effective For ginseng cell growth, 2,4 D is most commomly used in routine culture maintenance [6] But use of this suspected carcinogen often ... Inc., Cary, USA) Results and discussion To understand the culture characteristics of the suspended cells of ginseng in shake flask, the effect of plant growth regulators (2,4-D or IBA or NAA combination...
... under speci c conditions Analysis of the products of the reaction revealed the presence of guaiacylglycerol (GG) and 4MU (data not shown) Localization of enzymatic activity To confirm the localization ... HP, hyphae fraction; EC, extracellular fraction; CY, cytoplasmic fraction Control, GOU added to mL of VM (B) Assay of b-aryl ether cleavage by the extracellular fraction with a model compound that ... lignin-related compounds, p-hydroxybenzoic acid, gallic acid and vanillic acid, as a sole source of carbon Cell growth and the production of the b-aryl ether cleavage enzyme We cultured 2BW-1...
... 20 C- terminal amino acids, whereas in ScSerRSDC13, only the fragment of 13 amino acids (containing seven lysines) was cut off Truncated yeast SerRS constructs were fused to the C- terminal end of ... eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic SerRSs is shown in bold letters The sequence truncated ... specificity of the SerRS–Pex21p interaction, the full-length maize (Zea mays cytosolic, Zmc) SerRS (LexA–ZmcSerRS) and its truncated variant (LexA–ZmcSerRSDC26), lacking 26 C- terminal amino acids,...
... R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC Bioinformatic analyses Sequence similarity searches ... described for CCPs and MauGs In conclusion, we have described a novel C- type heme protein located to the cellular surface of the methanotrophic bacterium M capsulatus This protein shares characteristics ... Detection of C- type heme Because of the sequence similarity of SACCP to members of the BCCP family of proteins and the prediction of heme-binding motifs in the primary sequence, it was of interest...
... high level of secretion without QN (A 6C, A 6C/ C37S, S1 9C) However, coexpression induced a decrease, of 40%, in the secretion of mutant M2 1C/ C37S, for which complexes could not be detected (not ... the aromatic cluster, had very different effects, depending on the presence of cysteine C3 7 Without C3 7, mutant S1 9C/ C37S produced very low levels of cellular or secreted activity In contrast, ... W17P Transfection of COS cells COS cells were transfected by the DEAE-dextran method, as described previously [24], using lg of DNA encoding the AChE catalytic subunit and lg of DNA encoding QN...
... 5¢-GGTGTAGAATTCAAGAACGAGGAACTGCG-3¢ was combined with (a) 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for ... 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1– 220HIS (underlined EcoRI and NotI) ... ATTCCGGAACCAGGAGGAGCGC-3¢ was used in all cases, together with the reverse primer (a) 5¢-ATA GTTTAGCGGCCGCTTACTTGCGCTGGATGATGAG CAGG-3¢ for c1 –218, (b) 5¢-ATAGTTTAGCGGCCGC TTAGTGATGGTGATGGTGATGCTTGCGCTGGATG...
... interactions occurring in the concentration range of the critical micellar concentration (cmc) [17] For lysolecithin, the cmc is 20 lM, corresponding to Ri values of 5–6 and 30–40, for peptide concentrations ... interactions of AChET subunits Chemical grafting of synthetic peptides confers hydrophobic properties on water-soluble AChE To characterize the interactions of the t region while excluding possible effects ... were chemically coupled at the surface of a protein However, the t peptide is normally linked to the C- terminus of the catalytic domain of AChET subunits and it contains a cysteine (C3 7) which...
... ()740) 5¢-AGGT ACCCAATATTGGCCATTAGCC-3¢; CMV IE ()507) 5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢; CMV IE ()300) 5¢-TGGTACCATGCCCAGTACATGACCTTA-3¢; CMV IE ()185) 5¢-TGGTACCCGGTTTGACTCACG GGGATT-3¢; CMV IE ()130) ... TCCATGAGCTTCCTGACGTT); 1826(S-2, TCCATGACGTTCCTGAGCTT) and 1826(S-3, TCC ATGAGCTTCCTGAGCTT) The non-CpG-ODN 2041 (CTGGTCTTTCTGGTTTTTTTCTGG) served as a negative control The LPS content of ODNs was ... TCCATGCGTT CCTGACGTT Derivatives of the CpG-ODN 1826 sequence with one or two of the CG sequences reversed to GC (indicated by bold lettering) are as follows: CpG-ODN 1826(S-1, TCCATGAGCTTCCTGACGTT);...
... Scholarship (to M.F.) from the Natural Sciences and Engineering Research Council of Canada (NSERC) and by fellowship and grant support from the National Health and Medical Research Council of ... tubes Radioactivity was measured using a c- scintillation counter (LKB Wallace 1282 Compugamma) The effects of the well-characterized lysosomotropic agents, ammonium chloride (15 mM), chloroquine ... the cell occurred as a linear function of incubation time [correlation coefficient (r) ¼ 0.97] In contrast, the internalization of Tf occurred by a biphasic process consistent with RME (Fig 1B),...
... explosive chain-branched reaction, and another model describes the motion of pendulums, the dynamics of cryogenic electronic devices, and the dynamics of muscle contractions during childbirth Ordinary ... through the circuit The circuit is described by the mathematical equation C dV dt = I dI + RI = Vin − V dt The first equation describes the accumulation of charge in the capacitor; the second relates ... solutions either approach a critical point of the system, an oscillation, or they approach a necklace of critical points on a strand of orbits The proof of this result can be found in [24, 58,...
... FinancialPosition of Statements Incomeand the Fund Balance of Statements CashFlows of Notesto the FinancialStatements a Abbreviations DACS FDIC FFB FSLIC FIRRELA GCR RTC SAIF Page Division of Accountingand ... CorporateServices FederalDepositInsuranceCorporation FederalFinancingBank FederalSavingsand Loan InsuranceCorporation FinancialInstitutions Reform,Recovery, Enforcement of and Act 1989 GrossCashRecovery ... billion as of December 1, 199 This deficit reflects the Fund’ continued erosion through consecutive years of net losses s In 199 1, problems facing the banking industry became increasingly concentrated...
... transactions are executed in accordance with management’ s authorization and recorded properly to permit the preparation of financial statements in accordance with generally accepted accounting ... attendance accounting and reporting process Because FDIC allocates payroll expenses among the several funds it administers, lack of adherence to procedures over the time and attendance accounting ... financial reporting, consisting of the policies and procedures related to the form, content, and preparation of the Fund’ financial statements s For each of the internal control structure categories...
... Citicorp of the Delaware Brfdge Sank (the credft card subsidlary of Flrst RepublIcBankof Texas) Those funds were released In July of 1991 Cash and cash equivalentsas of December31 consisted of ... the sale of these assets (excluding cash and miscellaneousreceivableof S6.9bllllon) are regularlyevaluated,but remain subject to uncertaintiesbecause of changing economic condltlons affecting real ... dlstrlbuted In accordance with applicable laws and regulations Costs and expenses related to speclflc recetvershipsare charged directly to those recekershlps The BIF also recovers lndlrect liquldatlon...