c 892 968 holy roman empress queen of germany and saint
queen of air and darknesscharacter analysis
... different and balancingfeatures Gawaine is outgoing and quick to act, but he is balanced by Gaheris who isreclusive and slow to action Agravaine is sadistic and selfish, but he is balanced by Garethwho ... sadistic and selfish, but he is balanced by Garethwho is kind and generous They compliment each other and together are stronger thanthey can ever be apart ...
- 2
- 303
- 0
Tài liệu Outlines of Greek and Roman Medicine doc
... physicians in the reign of Nero, but none of great eminence Andromachus was physician to the Emperor, and had the title of archiater, which means "chief of the physicians." An account of the archiaters ... OF Greek and Roman Medicine 16 CHAPTER I 17 CHAPTER I EARLY ROMAN MEDICINE Origin of Healing Temples Lectisternium Temple of Æsculapius Archagathus Domestic Medicine Greek Doctors Cloaca Maxima ... Theories of Disease receive the Church's Sanction Monastic Medicine Miracles of Healing St Paul St Luke Proclus Practice of Anatomy denounced Christianity the prime factor in promoting Altruism CHAPTER...
- 85
- 298
- 0
Tài liệu Báo cáo khoa học: Oocyte membrane localization of vitellogenin receptor coincides with queen flying age, and receptor silencing by RNAi disrupts egg formation in fire ant virgin queens ppt
... region of the SiVgR gene (amino acid 648–878) using primer set VgRi-f1 (5¢-TAATACGACTCACTATA GGGGCCATCTGCAATTATCAACGCCTTTCTTAACG TC-3¢) and VgRi-r1 (5¢-TAATACGACTCACTATAGGG ACCACATACTGTGCATCGCGTGAATAAGGTGTC-3¢), ... sequence) [36] was amplified as template with primer set VgRi-f4 (5¢-TAATACGACT CACTATAGGGCGTGATCAGGTCAAAACGTATTTTC TTCATTT-3¢) and VgRi-r3 (5¢-TAATACGACTCACTATA GGGGCCACAGTCATCCTTTTTATCGCATACTAC-3¢) ... SiVgR-2.3-3-2, 5¢-ACAAGAGCCATTCTCTATGACGGTCTTTC-3¢, and SiVgR-2.3-4r, 5¢-CTGACCTGAGAGCGGATCAGATAT TATATTCAC-3¢, and the conditions were 94 C for min; 28 cycles of 94 C for 30 s, 60 C for and 72 C for...
- 14
- 482
- 0
Tài liệu Department of Health and Human Services 200 Independence Avenue S.W., Washington, D.C. 20201 doc
... regulating the manufacture, marketing and distribution of tobacco products, protecting public health and reducing tobacco use by minors Accordingly, the Center for Tobacco Products was established ... 2010, CDC is building a cadre of health protection researchers, research training programs, and centers of excellence that enable multidisciplinary approaches to public health practice Performance ... patients, clinicians, and other decision-makers about what interventions are most effective for patients under specific circumstances TRANSPARENCY AND ACCOUNTABILITY Transparency: HHS Recovery Act funds...
- 114
- 610
- 0
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
... were analyzed The percentages of the PrPC bands were calculated as arithmetic means and SE according to the antibody used for PrP detection Calculation of the banding patterns of 16 gels using antibody ... PrPC derived from cortex (c) , cerebellum (cb) and brain stem (bs) of sheep detected by antibodies SAF34 and SAF70, respectively (B) PrPC signals of cortex (c) , cerebellum (cb) and brain stem (bs) ... given for each antibody, and, accounting for differences among gel runs, SE values were calculated according to antibody used for PrP detection Calculation of the banding patterns of 17 gels using...
- 11
- 536
- 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... presence of an excess of nonspeci c competitor calf thymus DNA mimicking randomsequence natural genetic material that can accommodate the cisplatin adducts regardless of the reactivity 4700 Fig Competition ... DNA comprises about 50% of 1,2-GG IACs, 25% of 1,2-AG IACs, 10% of 1,3-GNG IACs and interstrand crosslinks, and another 2–3% of monofunctional adducts It has been found that cisplatin cytotoxicity ... forms [33] Recently, it has been reported that accessibility of the p53 CTDBS is critical for (sequence-nonspeci c) cisPtDNA recognition [34] On the other hand, sequencespeci c binding of p53 to...
- 14
- 597
- 0
Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc
... (1995) Cloning and characterization of a human protein kinase with homology to Ste20 J Biol Chem 270, 21695–21700 Creasy CL & Chernoff J (1995) Cloning and characterization of a member of the ... scaffold protein, connector enhancer of KSR1, CNK1, mediates the pro-apoptotic effects of a constitutively active Ras [15,25] Furthermore, Nore1 appears to direct recruitment of Mst1 to Ras complexes ... the C- terminal coiled-coil domains of Sav and Hpo were also crucial and ⁄ or sufficient for their interaction [19,21,23] These results indicate that the coiled-coil interaction between Mst and...
- 13
- 321
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) ... also cloned the cDNA encoding rabbit fast skeletal TnI from the back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) ... (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated by underlines and bold...
- 12
- 514
- 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased ... complementary primers 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All TAP constructs were transfected into T2 cells by electroporation using a ... 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ for 2V1 The resulting TAP constructs were cloned into the EcoRI site of pHbApr1neo [22] and sequenced fully...
- 16
- 407
- 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... nuclear genome coded isoforms of CytOX V [10,32] The regulation of genes CytOX5a and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and ... iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed under hypoxic (O2 < 0.5 lM) and heme ... the catalytic activity of the enzyme by affecting its stability or composition Although succinylacetone and CoCl2 are known inhibitors of heme biosynthesis, these agents also elicit nonspeci c and...
- 9
- 554
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... Hoganson, C. W., Babcock, G.T & Ferguson-Miller, S (1999) Definition of the interaction domain for cytochrome c on cytochrome c oxidase I Biochemical, spectral, and kinetic characterization of surface ... domains by chemical modification J Biol Chem 253, 149–159 Rieder, R & Bosshard, H.R (1980) Comparison of the binding sites on cytochrome c for cytochrome c oxidase, cytochrome bc1 and cytochrome c1 J ... the docked complex by a complete, systematic search J Biol Chem 274, 38051–38060 Michel, B & Bosshard, H.R (1984) Spectroscopic analysis of the interaction beween cytochrome c and cytochrome c oxidase...
- 9
- 457
- 1
Learning Patient-Specific Cancer Survival Distributions as a Sequence of Dependent Regressors docx
... discriminative power (i.e., classification accuracy) of the probability predictions Table shows the classification accuracy and MSE on the predicted probabilities of different models at 5, 12, and ... E.T McFadden, and P.P Carbone Toxicity and response criteria of the eastern cooperative oncology group American Journal of Clinical Oncology, 5(6):649, 1982 [2] J.D Kalbfleisch and R.L Prentice ... survival time can be appropriate In this case we can measure the loss Table 2: Classification accuracy and MSE of survival probability predictions on cancer registry dataset (standard error of 5CV shown...
- 9
- 449
- 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc
... (Varian Inc., Zug, Swizerland) Kinetic parameters were calculated using prism (GraphPad Software Inc., San Diego, CA, USA) Bioinformatics The molecular mass and theoretical extinction coefficient of ... importance of this accessory ‘caddie protein’ for copper incorporation into the Streptomyces tyrosinase [7,9] and the expression of active Streptomyces tyrosinase in either Escherichia coli or ... (2006) Crystallographic evidence that the dinuclear copper center of tyrosinase is flexible during catalysis J Biol Chem 281, 8981–8990 Klabunde T, Eicken C, Sacchettini JC & Krebs B (1998) Crystal...
- 13
- 778
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... late-endosome ⁄ vacuole Traf c 2, 622–630 Piper RC, Cooper AA, Yang H & Stevens TH (1995) VPS27 controls vacuolar and endocytic traf c through a prevacuolar compartment in Saccharomyces cerevisiae J Cell ... the conserved RDF sequence for assembly and activity can be overcome by addition of Vta1p and a second Vps4p molecule with an intact C- terminal helix We also find evidence for the co-evolution of...
- 23
- 490
- 0
Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx
... 5¢-CCT GGC TAC AAG ATA GTG GGC GGT GAA-3¢ and 5¢-TTC ACC GCC CAC TAT CTT GTA GCC AGG-3¢; and V406F, 5¢-CCT GGC TAC AAG TTC GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CGA ACT TGT AGC CAG G-3¢, respectively ... 5¢-TTC ACC GCC CAC TGC CTT GTA GCC AGG-3¢ and a soluble form of TNSALP (V406A), 5¢-GCA GCA AGG CTG CCT GCC TAG TGA TGG TGA TGG TGA TGG CTG GCA GGA GCA CA-3¢ TNSALP (V406L), TNSALP (V406I) and ... (V406F) were created using the QuikChange II Site-Directed Mutagenesis kit with the following primers: V406L, 5¢-CCT GGC TAC AAG CTG GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CCA GCT TGT AGCCAG G-3¢;...
- 11
- 500
- 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... tyrosine of this sequence is identified as Y7.53 Construction of mutated B1wt, B2wt and of the B1 ⁄ B2 receptor chimera Standard PCR techniques using either receptor-speci c or chimeric primers ... the transactivation of growth hormone receptors and in the activation of MAPK cascades, as well as different localizations of the receptor constructs before and after activation may also contribute ... Faussner et al Role of helix and C- termini in bradykinin receptors Fig Schematic representation of the C- terminal B1wt and B2wt sequences and chimera thereof The C- terminal sequences beginning at...
- 12
- 595
- 0
C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc
... (shuffled[]) and place random numbers from to 52 in it Once we have the random numbers, we just display the card names in that order string cards[52]={ "CA", "C2 ", "C3 ", "C4 ", "C5 ", "C6 ", "C7 ", "C8 ", "C9 ", "C1 0","CJ","CQ","CK", ... data, the second one to find the difference of each score from the mean and the third one to find store the square of deviation of each score The mean is calculated by adding all valid scores stored ... Read scores from a file into an array Keep track of number of scores entered Find difference of each score from the Mean Square the differences and add the squares find stadard deviation create...
- 7
- 416
- 1
![Báo cáo khoa học: Characterization of the bioactive conformation of the C-terminal tripeptide Gly-Leu-Met-NH2 of substance P using [3-prolinoleucine10]SP analogues pdf](https://media.store123doc.com/images/document/14/rc/ty/small_tyq1394220086.jpg)
Báo cáo khoa học: Characterization of the bioactive conformation of the C-terminal tripeptide Gly-Leu-Met-NH2 of substance P using [3-prolinoleucine10]SP analogues pdf
... Ca, Cb, Cc¢ atoms of the pyrrolidine cycle v1 and v2 torsion angles correspond to the side chain of the prolinoamino acid and are defined by Na, Ca, Cb, Cc and Ca, Cb, Cc, Cd(proR) atoms Ac-Pc3 ... Cb, Cc¢ atoms of the pyrrolidine cycle v1 and v2 torsion angles correspond to the side chain of the prolinoamino acid and are defined by Na, Ca, Cb, Cc and Ca, Cb, Cc, Cd(proR) atoms Ac-Pt3Leu-NHMe ... conformation of the crucial 9–11 tripeptide, which is necessary for the biological activity of SP Conclusion The comparison of conformational spaces of cis- and transprolinoamino acid allows one to access...
- 10
- 433
- 0
Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc
... primer (5¢-TCAGGAGCTAA GGAAGCTAAAATGGTGAGCAAGGGCGAG-3¢) and primer (5¢-CCGCTCGAGTTACTTGTACAGCTCGT CCATGCC-3¢) The splice-overlap PCR-product was cloned into pUC18 (NEB) and subsequently cloned into ... Lichtenthaler, ZMBH, Germany) , using primer (5¢-CCCAAGCTTGGGTGCCCCGCGC AGGGTCGCG-3¢) and primer (5¢-GTACTGTTTCTT CTTCAGCATCACC-3¢) The GAL4-VP16 DNA fragment (678 bp) was produced by PCR from pGAL4-VP16 ... pSP72 The hygromycin resistance gene was amplified from the pCEP4 plasmid (Invitrogen) with primer (5¢-GGACCAGACCCCACGCAACG-3¢) and primer 10 (5¢-GCCCTGCTTCATCCCCGTGG-3¢) and cloned into the pSP72/5GAL-E1bEGFP...
- 12
- 471
- 0
Outlines of Greek and Roman Medicine, by James Sands Elliott This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of docx
... in uncertainty The earliest practice of medicine was undoubtedly theurgic, and common to all primitive peoples The offices of priest and of medicine-man were combined in one person, and magic was ... Empiricism Serapion of Alexandria CHAPTER V Roman Medicine at the end of the Republic and the Beginning of the Empire Asclepiades of Prusa Themison of Laodicea Methodism Wounds of Julius C sar ... Alexander of Tralles The Plague Moschion Paulus Ægineta Decline of Healing Art CHAPTER XI Influence of Christianity on Altruism and the Healing Art Essenes Cabalists and Gnostics Object of Christ's...
- 425
- 659
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu