... of cytochrome c and second mitochondria-derived activator of caspase (Smac ⁄ DIABLO) allows for the formation ofthe apoptosome, a complex that enables the activation of caspases within the cell ... in the presence ofthe JNK inhibitor SP600125 or in control conditions (Fig 3C) Although the presence ofthe inhibitor had no significant effect on cell survival or caspase activity in control cells ... stimulation activates the nuclear factor kappa-light-chainenhancer of activated B cells (NFjB) pathway, inducing expression of Mcl-1, which also blocks recruitment of Bax and Bak to the mitochondria...
... sites of IC The crystal structure of IC in the complex with CPY is represented as a surface model (A) The binding interface between IC and CPY The IC residues at the buried surface in the complex ... membrane binding of IC and IC–CPY IC (bold solid lines) or IC–CPY (solid lines), the concentration of which was lM, was injected for 90 s over the surface ofthe L1 sensor chip coated with the phospholipid ... also the vacuolar 5378 lumens in the majority of yeast cells (70% ofthe cells grown at 72 h; right panels of Fig 3A,B) Therefore, the fluorescence microscopic analyses clearly demonstrate that IC–GFP...
... 5¢-GGACTCAAGAGAGGAACCTG-3¢; F1b, 5¢-CT GCCTTGCTCCACACCTG-3¢; F 1c, 5¢-CTGCCGTCTCC GCCGCCACT-3¢; FU, 5¢-TCAAGCCCCGCTACATAG TT-3¢; and R3, 5¢-AGGAACCAAACACCAAGTGG-3¢ (Fig 2A) Luciferase promoter ... 5¢-CCAGGCCTCTAGAATTCTGCAGTT-3¢ The synthesized primer sequence contained a codon for the Ser instead ofthe Met Both PCR fragments were fused at the XbaI site and subcloned into pcDNA3.1 Myc-His ... inactivated in cancer cells There may be silencer sequence speci c for cancer cells at the promoter region Such negative regulation of KLK11 expression in prostate cancer cells is compatible with the observation...
... immunocompetent mice infected with CVB3 [67,109] In the immunodeficient mice, the CVB3 infection led to chronic myocarditis characterized by marked cell infiltration to the myocardium, and necrosis of ... family because they encode the highly conserved cystine knot motif characteristic ofthe growth factor family While the classical PDGF-a and PDGF-b mainly encode the growth factor domain, PDGF -c and ... sequences [41] but contain dibasic cleavage sites for proteolytic removal ofthe CUB domains and thereby activation ofthe growth factor domains PDGF -C and -D contain both the CUB and growth factor...
... shown that the presence ofthe remainder ofthe acidic tail results in the thermodynamic stabilization of Hfq by 1.8 kcalÆmol)1 A comparison ofthe average electron microscopy images of HfqNter ... Firmicutes, Bacillus/clostridium group – Clope, Clostridium perfringens; Thetn, Thermoanaerobacter tengcongensis Bacillus/staphylococcus group – Bachd, Bacillus halodurans; Stau, Staphylococcus ... Amino acids characteristic of Hfq are indicated in black Amino acids in light grey are conserved in most Hfqs and located in the b-strands Acidic amino acids at the end of Hfq sequences are indicated...
... also cloned the cDNA encoding rabbit fast skeletal TnI from the back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) ... 232–292), combinations ofthe forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ... to actin-tropomyosin and TnC To understand the biological significance ofthe difference in TnI–TnC interactions, we compared the ability of TnC to neutralize the inhibitory effects ofthe C- terminal...
... 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ ... used the complementary primers 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ ... TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased from ARK/Sigma The chimeric TAP construct 1V2 was created by ligation ofthe 1.6 kb ScaIfragment containing the...
... theC signal ofthe preceding amino acid, correlating the amide HN and the Ca signals, correlating the amide HN and the Ca signal ofthe preceding amino acid, correlating the amide NH with the ... for the determination ofthe structures ofthe conformers ofthe C- domain The dipolar couplings provided long-distance information on the global folding of both conformers The structure ofthe ... that were confirmed by the corresponding set of NOEs Dynamic properties ofthe C- domain The C- domain reveals a rather complex picture ofthe mobility of its protein backbone Analysis ofthe 15 N-relaxation...
... 154–157 The Caxton Press, Canterbury University, Christchurch Pucciarelli S & Miceli C (2002) Characterization ofthe cold-adapted alpha-tubulin from the psychrophilic ciliate Euplotes focardii ... including the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe Thus, our comparative analysis ofthe c- tubulins of psychrophilic and mesophilic Euplotes species should contribute ... resolving the validity ofthe template versus protofilament models of c- TuRC-mediated nucleation of microtubules Experimental procedures Cell culture and cell cycle synchronization Cultures of E focardii...
... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E190A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E190A, 5¢-CAAATTGGGGG ... CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E199A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E204A Mutated codons ... 5886 The alteration ofthe properties ofthe C- terminal extension also leads to significant changes to the structure and function of sHsps The chaperone activity of Hsp3 0C is impaired when the...
... where the coefficients ofthe cubic equation, a and b, are obtained from the coefficients ofthe linear regression ofthe experimental J(xN) (i.e the spectral density function at the Larmor frequency ... monomeric CACW40A Subsequently, we examine the biological and thermodynamical implications of such a high flexibility Backbone dynamics and the relationship to structure in CACW40A Fig The reduced ... J(0.87xH) correspond to the termini ofthe helices and the regions in between, indicating efficient picosecond averaging In conclusion, using the reduced spectral density approach, analysis ofthe relaxation...
... (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5¢-CGGGATCCCGC TGCTGGTATCGCTCCTTTG-3¢), ... CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and TATGTCTTT (P 9C) , were also synthesized chemically The underlined sequences are changes from the original ... 5¢-GGGGCTTGATCTCAAAATGA-3¢ The caspase-10 gene-speci c primers were: forward, 5¢-GA CGCCTTGATGCTTTCTTC-3¢; reverse, 5¢-ATGAAGGC GTTAACCACAGG-3¢ PCR conditions for these two genes were similar, except...
... is catalytically inactive and specifically present in the nucleus of transfected COS-7 cells In contrast, all three forms carrying a complete catalytical domain are catalytically active and localized ... La Jolla, CA) (18 cycles: 94 C for min, 55 C for min, 72 C for min, followed by a single incubation at 72 C for 10 min) using primer P1, 5¢-CGCCA AGATTCCTCTGGGAACTCCAGCGACAGT-3¢ (nucleotides ... was found in the vesicle fraction To examine the specificity ofthe effect of PtdInsP2 shown in Fig 5A, purified mGRK6 -C was incubated with increasing concentrations of PtdCho vesicles containing...
... species, most likely corresponding to compact Ssa1p species, were observed in the presence of ATP No change in the mobility ofthe Ure2p–Ssa1p complexes was detected in the presence of ATP The ... Thus, the binding of Ssa1p in the vicinity of this stretch interferes with Ure2p assembly into fibrils either because of a change in the conformation of this stretch or the crowding of a surface ... MALDI-TOF-TOF mass spectrometry A selection of mass spectra illustrates how the comparison of chymotryptic peptides from different cross-linked complexes and protein controls allows the detection of...
... pmol of HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of [c- 32P]ATP (3000 CiÆmmol)1; GE Healthcare) and 100 units of T4 ... way The oligonucleotide WT was used as a template for amplification of a 70 bp PCR product with [5¢-32P]-labeled S70ds ⁄ UP (5¢-AATTGATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG CAGCGGCGCCATGTT-3¢) ... splicing [12] The En domain, which carries out second-strand cleavage to generate the primer for reverse transcription ofthe inserted intron RNA, contains sequence motifs characteristic of the...
... Billerica, MA, USA), which recognizes the N-terminus of APP, the polyclonal antiserum C8 , which recognizes the C- terminus of APP, and the polyclonal antiserum D2-II, which recognizes the ectodomain ... regulate the nuclear translocation ofthe intracellular C- terminal domain (ICD) ofthe APP family of proteins Biochemistry 42, 6664–6673 Cao X & Sudhof TC (2001) A transcriptionally [correction of ... the presence or absence of BACE1 The levels of APPsa increased to account for the loss of APPsb (soluble C- terminally truncated b-cleaved form of amyloid precursor protein) in BACE1 KO mice, FEBS...
... region of CS is a repeating disaccharide of glucuronic acid (GlcA) and N-acetylgalactosamine (GalNAc) [-4)GlcA(b1– 3)GalNAc(b1-]n, which may be O-sulfated on the C4 and ⁄ or C6 of GalNAc and C2 of ... CS060# and CS#60# Residue Carbon CS040# (p.p.m.) CS060# (p.p.m.) CS#60# (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C6 C1 C2 C3 C4 C5 C6 CH3 C O C1 C2 C3 C4 C5 102.83 71.54 67.51 109.41 147.01 – 102.97 55.02 ... 4-sulfated GalNAc residue Table Carbon chemical shift Dd values between CS040# and CS060# Residue Carbon Calculated (p.p.m.) Observed (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C1 C2 C3 C4 C5 C6 +1.1 +0.9...
... approach with the intermediate pituitary melanotrope cells ofthe South-African clawtoed frog Xenopus laevis Depending on the colour ofthe background ofthe animal (black or white), these cells ... examine the effect ofthe overexpressed Xenopus GFP–PrPC protein on the biosynthesis and processing of POMC as well as the secretion ofthe POMCderived products, we performed pulse and pulse–chase ... PrPC and our preliminary studies on the effect ofthe overexpressed PrPC show that the transgene product does not affect the functioning of a neuroendocrine cell With the availability of the...
... glucose-6-phosphate C1 and C6 concentration, respectively Because the rate of label incorporation into glycogen C1 , the relative isotopic enrichments of glycogen C1 and C6 , and the net glycogen synthesis ... resolve the resonance of glycerol C1 , C3 at 62.5 p.p.m from the resonance of glycogen C6 allowed, for the first time, the measurement of glycogen C6 changes in vivo, which reflects the indirect pathway ... relative to the rate of label incorporation into glycogen C1 reflects the relative isotopic enrichment of Glc6P in the C6 relative to the C1 position When the changes in glycogen C1 and C6 are linear...
... interaction may be an artifact caused by the crystallization of lactose-liganded EW29Ch because: (a) in the other EW29Ch molecule ofthe crystal structure (each crystal contained two molecules ... increasing concentrations of each sugar For the progressive chemical-shift changes of EW29Ch under conditions of fast exchange on the chemical-shift timescale, 15N and 1HN chemical-shift changes ... sites in EW29Ch is expected to elucidate the molecular basis ofthe carbohydrate cross-linking properties ofthe lectin In this study, the sugar-binding ability and specificity of each ofthe two sugar-binding...