0

c 654 c 714 noblewoman of the house of pepin

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Báo cáo khoa học

... of cytochrome c and second mitochondria-derived activator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the activation of caspases within the cell ... in the presence of the JNK inhibitor SP600125 or in control conditions (Fig 3C) Although the presence of the inhibitor had no significant effect on cell survival or caspase activity in control cells ... stimulation activates the nuclear factor kappa-light-chainenhancer of activated B cells (NFjB) pathway, inducing expression of Mcl-1, which also blocks recruitment of Bax and Bak to the mitochondria...
  • 12
  • 718
  • 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Báo cáo khoa học

... sites of IC The crystal structure of IC in the complex with CPY is represented as a surface model (A) The binding interface between IC and CPY The IC residues at the buried surface in the complex ... membrane binding of IC and IC–CPY IC (bold solid lines) or IC–CPY (solid lines), the concentration of which was lM, was injected for 90 s over the surface of the L1 sensor chip coated with the phospholipid ... also the vacuolar 5378 lumens in the majority of yeast cells (70% of the cells grown at 72 h; right panels of Fig 3A,B) Therefore, the fluorescence microscopic analyses clearly demonstrate that IC–GFP...
  • 10
  • 645
  • 1
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

Báo cáo khoa học

... 5¢-GGACTCAAGAGAGGAACCTG-3¢; F1b, 5¢-CT GCCTTGCTCCACACCTG-3¢; F 1c, 5¢-CTGCCGTCTCC GCCGCCACT-3¢; FU, 5¢-TCAAGCCCCGCTACATAG TT-3¢; and R3, 5¢-AGGAACCAAACACCAAGTGG-3¢ (Fig 2A) Luciferase promoter ... 5¢-CCAGGCCTCTAGAATTCTGCAGTT-3¢ The synthesized primer sequence contained a codon for the Ser instead of the Met Both PCR fragments were fused at the XbaI site and subcloned into pcDNA3.1 Myc-His ... inactivated in cancer cells There may be silencer sequence speci c for cancer cells at the promoter region Such negative regulation of KLK11 expression in prostate cancer cells is compatible with the observation...
  • 9
  • 544
  • 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Báo cáo khoa học

... immunocompetent mice infected with CVB3 [67,109] In the immunodeficient mice, the CVB3 infection led to chronic myocarditis characterized by marked cell infiltration to the myocardium, and necrosis of ... family because they encode the highly conserved cystine knot motif characteristic of the growth factor family While the classical PDGF-a and PDGF-b mainly encode the growth factor domain, PDGF -c and ... sequences [41] but contain dibasic cleavage sites for proteolytic removal of the CUB domains and thereby activation of the growth factor domains PDGF -C and -D contain both the CUB and growth factor...
  • 19
  • 557
  • 0
Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

Báo cáo khoa học

... shown that the presence of the remainder of the acidic tail results in the thermodynamic stabilization of Hfq by 1.8 kcalÆmol)1 A comparison of the average electron microscopy images of HfqNter ... Firmicutes, Bacillus/clostridium group – Clope, Clostridium perfringens; Thetn, Thermoanaerobacter tengcongensis Bacillus/staphylococcus group – Bachd, Bacillus halodurans; Stau, Staphylococcus ... Amino acids characteristic of Hfq are indicated in black Amino acids in light grey are conserved in most Hfqs and located in the b-strands Acidic amino acids at the end of Hfq sequences are indicated...
  • 8
  • 427
  • 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Báo cáo khoa học

... also cloned the cDNA encoding rabbit fast skeletal TnI from the back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) ... 232–292), combinations of the forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ... to actin-tropomyosin and TnC To understand the biological significance of the difference in TnI–TnC interactions, we compared the ability of TnC to neutralize the inhibitory effects of the C- terminal...
  • 12
  • 514
  • 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Báo cáo khoa học

... 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ ... used the complementary primers 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ ... TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased from ARK/Sigma The chimeric TAP construct 1V2 was created by ligation of the 1.6 kb ScaIfragment containing the...
  • 16
  • 407
  • 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Báo cáo khoa học

... the C signal of the preceding amino acid, correlating the amide HN and the Ca signals, correlating the amide HN and the Ca signal of the preceding amino acid, correlating the amide NH with the ... for the determination of the structures of the conformers of the C- domain The dipolar couplings provided long-distance information on the global folding of both conformers The structure of the ... that were confirmed by the corresponding set of NOEs Dynamic properties of the C- domain The C- domain reveals a rather complex picture of the mobility of its protein backbone Analysis of the 15 N-relaxation...
  • 17
  • 490
  • 0
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc

Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc

Báo cáo khoa học

... 154–157 The Caxton Press, Canterbury University, Christchurch Pucciarelli S & Miceli C (2002) Characterization of the cold-adapted alpha-tubulin from the psychrophilic ciliate Euplotes focardii ... including the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe Thus, our comparative analysis of the c- tubulins of psychrophilic and mesophilic Euplotes species should contribute ... resolving the validity of the template versus protofilament models of c- TuRC-mediated nucleation of microtubules Experimental procedures Cell culture and cell cycle synchronization Cultures of E focardii...
  • 16
  • 467
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học

... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E190A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E190A, 5¢-CAAATTGGGGG ... CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E199A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E204A Mutated codons ... 5886 The alteration of the properties of the C- terminal extension also leads to significant changes to the structure and function of sHsps The chaperone activity of Hsp3 0C is impaired when the...
  • 14
  • 417
  • 0
Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx

Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx

Báo cáo khoa học

... where the coefficients of the cubic equation, a and b, are obtained from the coefficients of the linear regression of the experimental J(xN) (i.e the spectral density function at the Larmor frequency ... monomeric CACW40A Subsequently, we examine the biological and thermodynamical implications of such a high flexibility Backbone dynamics and the relationship to structure in CACW40A Fig The reduced ... J(0.87xH) correspond to the termini of the helices and the regions in between, indicating efficient picosecond averaging In conclusion, using the reduced spectral density approach, analysis of the relaxation...
  • 13
  • 421
  • 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học

... (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5¢-CGGGATCCCGC TGCTGGTATCGCTCCTTTG-3¢), ... CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and TATGTCTTT (P 9C) , were also synthesized chemically The underlined sequences are changes from the original ... 5¢-GGGGCTTGATCTCAAAATGA-3¢ The caspase-10 gene-speci c primers were: forward, 5¢-GA CGCCTTGATGCTTTCTTC-3¢; reverse, 5¢-ATGAAGGC GTTAACCACAGG-3¢ PCR conditions for these two genes were similar, except...
  • 14
  • 393
  • 0
Báo cáo khoa học: The variable C-terminal extension of G-protein-coupled receptor kinase 6 constitutes an accessorial autoregulatory domain ppt

Báo cáo khoa học: The variable C-terminal extension of G-protein-coupled receptor kinase 6 constitutes an accessorial autoregulatory domain ppt

Báo cáo khoa học

... is catalytically inactive and specifically present in the nucleus of transfected COS-7 cells In contrast, all three forms carrying a complete catalytical domain are catalytically active and localized ... La Jolla, CA) (18 cycles: 94 C for min, 55 C for min, 72 C for min, followed by a single incubation at 72 C for 10 min) using primer P1, 5¢-CGCCA AGATTCCTCTGGGAACTCCAGCGACAGT-3¢ (nucleotides ... was found in the vesicle fraction To examine the specificity of the effect of PtdInsP2 shown in Fig 5A, purified mGRK6 -C was incubated with increasing concentrations of PtdCho vesicles containing...
  • 13
  • 424
  • 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Báo cáo khoa học

... species, most likely corresponding to compact Ssa1p species, were observed in the presence of ATP No change in the mobility of the Ure2p–Ssa1p complexes was detected in the presence of ATP The ... Thus, the binding of Ssa1p in the vicinity of this stretch interferes with Ure2p assembly into fibrils either because of a change in the conformation of this stretch or the crowding of a surface ... MALDI-TOF-TOF mass spectrometry A selection of mass spectra illustrates how the comparison of chymotryptic peptides from different cross-linked complexes and protein controls allows the detection of...
  • 12
  • 510
  • 0
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

Báo cáo khoa học

... pmol of HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of [c- 32P]ATP (3000 CiÆmmol)1; GE Healthcare) and 100 units of T4 ... way The oligonucleotide WT was used as a template for amplification of a 70 bp PCR product with [5¢-32P]-labeled S70ds ⁄ UP (5¢-AATTGATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG CAGCGGCGCCATGTT-3¢) ... splicing [12] The En domain, which carries out second-strand cleavage to generate the primer for reverse transcription of the inserted intron RNA, contains sequence motifs characteristic of the...
  • 11
  • 398
  • 0
Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot

Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot

Báo cáo khoa học

... Billerica, MA, USA), which recognizes the N-terminus of APP, the polyclonal antiserum C8 , which recognizes the C- terminus of APP, and the polyclonal antiserum D2-II, which recognizes the ectodomain ... regulate the nuclear translocation of the intracellular C- terminal domain (ICD) of the APP family of proteins Biochemistry 42, 6664–6673 Cao X & Sudhof TC (2001) A transcriptionally [correction of ... the presence or absence of BACE1 The levels of APPsa increased to account for the loss of APPsb (soluble C- terminally truncated b-cleaved form of amyloid precursor protein) in BACE1 KO mice, FEBS...
  • 16
  • 549
  • 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

Báo cáo khoa học

... region of CS is a repeating disaccharide of glucuronic acid (GlcA) and N-acetylgalactosamine (GalNAc) [-4)GlcA(b1– 3)GalNAc(b1-]n, which may be O-sulfated on the C4 and ⁄ or C6 of GalNAc and C2 of ... CS060# and CS#60# Residue Carbon CS040# (p.p.m.) CS060# (p.p.m.) CS#60# (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C6 C1 C2 C3 C4 C5 C6 CH3 C O C1 C2 C3 C4 C5 102.83 71.54 67.51 109.41 147.01 – 102.97 55.02 ... 4-sulfated GalNAc residue Table Carbon chemical shift Dd values between CS040# and CS060# Residue Carbon Calculated (p.p.m.) Observed (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C1 C2 C3 C4 C5 C6 +1.1 +0.9...
  • 11
  • 481
  • 0
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

Báo cáo khoa học

... approach with the intermediate pituitary melanotrope cells of the South-African clawtoed frog Xenopus laevis Depending on the colour of the background of the animal (black or white), these cells ... examine the effect of the overexpressed Xenopus GFP–PrPC protein on the biosynthesis and processing of POMC as well as the secretion of the POMCderived products, we performed pulse and pulse–chase ... PrPC and our preliminary studies on the effect of the overexpressed PrPC show that the transgene product does not affect the functioning of a neuroendocrine cell With the availability of the...
  • 16
  • 431
  • 0
Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx

Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx

Báo cáo khoa học

... glucose-6-phosphate C1 and C6 concentration, respectively Because the rate of label incorporation into glycogen C1 , the relative isotopic enrichments of glycogen C1 and C6 , and the net glycogen synthesis ... resolve the resonance of glycerol C1 , C3 at 62.5 p.p.m from the resonance of glycogen C6 allowed, for the first time, the measurement of glycogen C6 changes in vivo, which reflects the indirect pathway ... relative to the rate of label incorporation into glycogen C1 reflects the relative isotopic enrichment of Glc6P in the C6 relative to the C1 position When the changes in glycogen C1 and C6 are linear...
  • 9
  • 465
  • 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

Báo cáo khoa học

... interaction may be an artifact caused by the crystallization of lactose-liganded EW29Ch because: (a) in the other EW29Ch molecule of the crystal structure (each crystal contained two molecules ... increasing concentrations of each sugar For the progressive chemical-shift changes of EW29Ch under conditions of fast exchange on the chemical-shift timescale, 15N and 1HN chemical-shift changes ... sites in EW29Ch is expected to elucidate the molecular basis of the carbohydrate cross-linking properties of the lectin In this study, the sugar-binding ability and specificity of each of the two sugar-binding...
  • 11
  • 458
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008