c 1496 1524 duchess of albany and countess of auvergne

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Ngày tải lên : 22/02/2014, 04:20
... enhancing effect of TS on LPS/IFN-induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives on the enhancement by TS of LPS/IFN-induced NO production ... N., Mayne, G .C. , Olejnicka, B., Negre-Salvayre, A., Stı´ cha, M., Coffey, R.J & Weber, C (2001) Induction of cancer cell apoptosis by a-tocopheryl succinate: molecular pathways and structural requirements ... (Ro31-8220 and GF109203X) on the enhancement by TS of LPS/IFNinduced NO production in VSMC (A), and Western blot analysis of PKCa in control VSMC, VSMC treated with LPS/IFN and VSMC treated with TS and...
  • 6
  • 494
  • 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

Ngày tải lên : 07/03/2014, 03:20
... Idi1 forward, CCTAGCTTGGCTGACAGAGG; reverse, CTGCTCCTTCTCCTTCATGC forward, TACAACCACAAGGCGCTACA; reverse, AAGGGCCTGACTCCATAGGT forward, CAGGAAGAACCGTTGGAGTT; reverse, TTGCTCTCGTTCCAAAAGGA forward, ... AAGGAAGGCTGGAAAAGAGC reverse, TACAGCTTCACCACCACAGC forward, TTTGATGCAGGTGTTTGAGG reverse, CCACCTGTAGGTCTGGCA forward, CCTTGCCCTACAGCTGAGTC reverse, CTTGTCTTCTGTGCCTGTGC forward, GTTTGAATTGGCCAGAGGAA ... AGGTGCAGCAGCTTCAGTTT forward, CAGTGCTGGAATTGTACGTGA reverse, AGTCCATGAGTTGGCCCATA forward, CCTATGAGCACCTGACCACA reverse, AGGCCACTGACTAGGCTGAA forward, GAGCAGGTCCAGGAACATTG reverse, GGGATAACTCGTCTCCACCA...
  • 12
  • 560
  • 0
C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc

C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc

Ngày tải lên : 08/03/2014, 00:20
... (shuffled[]) and place random numbers from to 52 in it Once we have the random numbers, we just display the card names in that order string cards[52]={ "CA", "C2 ", "C3 ", "C4 ", "C5 ", "C6 ", "C7 ", "C8 ", "C9 ", "C1 0","CJ","CQ","CK", ... data, the second one to find the difference of each score from the mean and the third one to find store the square of deviation of each score The mean is calculated by adding all valid scores stored ... Read scores from a file into an array Keep track of number of scores entered Find difference of each score from the Mean Square the differences and add the squares find stadard deviation create...
  • 7
  • 416
  • 1
Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx

Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx

Ngày tải lên : 14/03/2014, 10:20
... tissue culture process in order to be economically competitive with field cultivation of ginseng A number of physical and chemical factors that could influence secondary metabolite in plant cell cultures ... of the hormone concentration and combination are often effective For ginseng cell growth, 2,4 D is most commomly used in routine culture maintenance [6] But use of this suspected carcinogen often ... established cell suspension culture of ginseng cell and some attempts have been made to increase biomass and ginsenoside yield of ginseng cell culture Materials and methods Stock cell culture and culture...
  • 6
  • 492
  • 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Ngày tải lên : 15/03/2014, 10:20
... In the case of mant-GTP association, it was necessary to use increasing concentrations of the nucleotide because of nucleotide hydrolysis (0.5 lm of protein was mixed with increasing concentrations ... increase in fluorescence is indicative of a non-solvent-accessible binding pocket, as found in the crystal structure of hGBP1 [20,21] Analysis of the fluorescence intensities using a quadratic ... rates of mant-GDP (filled circles) and mant-GTPcS (open circles) association are plotted against the protein concentration (C) Observed association rates of mant-GTP with hGBP5a ⁄ b (open circles)...
  • 9
  • 462
  • 0
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Ngày tải lên : 23/03/2014, 09:20
... eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic SerRSs is shown in bold letters The sequence truncated ... representation and western blot analysis of full-length and deletion constructs of yeast (S cerevisiae, Sc) and maize cytosolic (Z mays, Zmc) SerRS (A) The names of the constructs used as baits ... specificity of the SerRS–Pex21p interaction, the full-length maize (Zea mays cytosolic, Zmc) SerRS (LexA–ZmcSerRS) and its truncated variant (LexA–ZmcSerRSDC26), lacking 26 C- terminal amino acids,...
  • 12
  • 406
  • 0
Báo cáo khoa học: Elements of the C-terminal t peptide of acetylcholinesterase that determine amphiphilicity, homomeric and heteromeric associations, secretion and degradation docx

Báo cáo khoa học: Elements of the C-terminal t peptide of acetylcholinesterase that determine amphiphilicity, homomeric and heteromeric associations, secretion and degradation docx

Ngày tải lên : 23/03/2014, 12:20
... dimerization and reduced the level of secreted tetramers, as discussed above Fig Effects of the C- terminal cysteine (C3 7), of C- terminal segments and of a KDEL motif on acetylcholinesterase (AChE) molecular ... there was no interaction with QN in the case of W17L and W17P, a very small production of T4–QN in the case of W17A, and a significant production of this complex in the case of W17F and W17H For these ... W17P Transfection of COS cells COS cells were transfected by the DEAE-dextran method, as described previously [24], using lg of DNA encoding the AChE catalytic subunit and lg of DNA encoding QN...
  • 12
  • 309
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGTCTGCCCTGACTCAGCCTGC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC...
  • 11
  • 679
  • 0
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

Ngày tải lên : 30/03/2014, 13:20
... interactions occurring in the concentration range of the critical micellar concentration (cmc) [17] For lysolecithin, the cmc is 20 lM, corresponding to Ri values of 5–6 and 30–40, for peptide concentrations ... Prediction of secondary structure elements The secondary structure of the C- terminal region of the catalytic domain and of the t peptide was predicted according to Rost [27] using PREDICTPROTEIN ... Switzerland) spectrometer at 25 C, using ¨ cuvettes of 0.1–1 cm path-length according to the concentration of peptide The blank was subtracted in all cases For evaluation of the molar ellipticity...
  • 15
  • 333
  • 0
Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

Ngày tải lên : 30/03/2014, 13:20
... 5¢-primers, CMV IE ()740) 5¢-AGGT ACCCAATATTGGCCATTAGCC-3¢; CMV IE ()507) 5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢; CMV IE ()300) 5¢-TGGTACCATGCCCAGTACATGACCTTA-3¢; CMV IE ()185) 5¢-TGGTACCCGGTTTGACTCACG GGGATT-3¢; ... 1826(S-1, TCCATGAGCTTCCTGACGTT); 1826(S-2, TCCATGACGTTCCTGAGCTT) and 1826(S-3, TCC ATGAGCTTCCTGAGCTT) The non-CpG-ODN 2041 (CTGGTCTTTCTGGTTTTTTTCTGG) served as a negative control The LPS content of ODNs ... TAatcGAtTTTCCTACT-3¢; mNF-jB3, 5¢-GTTTGACT CAatcGatTTTCCAAGTC-3¢; mNF-jB4, 5¢-CCAAAAT CAAatcGatTTTCCAAAATG-3¢; mAP-1, 5¢-TAGCGG TTTatCgatCGGGGATTTCC-3¢ Mutated sites are indicated with lower case letters...
  • 12
  • 330
  • 0
Báo cáo hóa học: " Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses" pptx

Báo cáo hóa học: " Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses" pptx

Ngày tải lên : 20/06/2014, 01:20
... volume containing either μl of the RT product (in the case of first round PCR) or μl of the first round PCR product (in the case of hemi-nested PCR), μl of 10× PCR buffer, 100 μM of each dNTP, ... work, recruitment of the patient, procurement of specimens and participated in proofreading of the manuscript; FG -C coordinated the study, interpreted data, co-performed phylogenetic and genetic analyses ... sequence has been deposited in EMBL with accession number AM910652 Phylogenetic reconstructions and genetic distances Two sets of nucleotide sequences were analysed: one corresponding to the complete...
  • 7
  • 434
  • 0
Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

Ngày tải lên : 20/06/2014, 01:20
... preparation of manuscript CM contributed to the experiments and data analysis JL determined qualitative, quantitative and genotype of clinical specimens described here OC and EKW are clinicians who ... manage HCV at Cork University Hospital LJF supervised the project and 17 18 19 Bowen DG, Walker CM: The origin of quasispecies: cause or consequence of chronic hepatitis C viral infection? J ... http://www.virologyj.com/content/5/1/103 Figure Phylogenetic trees of all viral E1/E2 amino acid sequences encompassing the HVR1 within each fraction Phylogenetic trees of all viral E1/E2 amino acid sequences encompassing...
  • 9
  • 288
  • 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Ngày tải lên : 20/06/2014, 01:20
... NS UCGUCUUCGUCUCCUAACCUU(UAC) UCGUCUUCGUCUCCUAA(UAC) UCGUCUUCGUCCCCUAGGCUU(UAC) UCGUCUUCGUCCCCCAAUUAU(UAC) UCGUCUUCGUCCUCUAAACCAAAAGUUUU(UAC) UCGUCUUCGUCCCCUGAAAAUUUGU(UAC) UCGUCUUCGUCCCCAUGAAAAAGUUU(UAC) ... AGCAGUAGCAAGAGGAUUUUUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUAUCUUUUUCACAUUCUUAUUUACAUCGCUUGAUGC A GCCCUUUGUGAGGCUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACUUA AGCAGUAGCAAGAGGAUUUUUAGCAAGACCUA ... AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA)...
  • 11
  • 427
  • 0
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt

Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt

Ngày tải lên : 06/07/2014, 08:20
... Function of Soils for Human Societies and the Environment Geological Society, London, Special Publications, 266, 89-115 GEOLOGICAL SOCIETY SPECIAL PUBLICATION NO 266 Function of Soils for Human Societies ... substantial discounts on publications of GSL and other societies worldwide, consult www.geolsoc.org.uk, or contact the Fellowship Department at: The Geological Society, Burlington House, Piccadilly, ... publications at a discount The Society's online bookshop (accessible from www.geolsoc.org.uk) offers secure book purchasing with your credit or debit card To find out about joining the Society and benefiting...
  • 5
  • 287
  • 0
Designation: C 184 – 94e1 - Fineness of Hydraulic Cement by the 150-µm (No. 100) and 75-µm (No. 200) Sieves1 ppt

Designation: C 184 – 94e1 - Fineness of Hydraulic Cement by the 150-µm (No. 100) and 75-µm (No. 200) Sieves1 ppt

Ngày tải lên : 10/07/2014, 23:20
... hydraulic cement; sieve C 184 ANNEX (Mandatory Information) A1 METHOD FOR DETERMINATION OF SIEVE CORRECTION can be read off the plot and the difference between the actual obtained residue and the ... revision of this standard or for additional standards and should be addressed to ASTM Headquarters Your comments will receive careful consideration at a meeting of the responsible technical committee, ... typical fineness as the range at which the sieve is to be used Determine the percent residue of the test material on each of the three sieves, in accordance with Section Plot the average percent...
  • 3
  • 1.3K
  • 14
Designation: C 243 – 95 - Bleeding of Cement Pastes and Mortars1 potx

Designation: C 243 – 95 - Bleeding of Cement Pastes and Mortars1 potx

Ngày tải lên : 10/07/2014, 23:20
... Bleeding Capacity—Calculate the bleeding capacity as follows: Tests on Mortars 8.1 Batch—The mortar mix shall consist of 930 g of cement and 2325 g of graded sand as specified in Specification C 778 ... 5.1 Many chlorinated hydrocarbons are considered to be toxic substances which can be absorbed through the skin, but the major exposure is from inhalation of vapors Chronic poisoning can occur from ... Let the paste stand for During the first 15 s of C 243 mix in accordance with the procedure described in the Determination of Flow Section of Test Method C 109, with the following exceptions: 8.3.1...
  • 4
  • 651
  • 1
Báo cáo y học: "Antimelanogenic effect of c-phycocyanin through modulation of tyrosinase expression by upregulation of ERK and downregulation of p38 MAPK signaling pathway" docx

Báo cáo y học: "Antimelanogenic effect of c-phycocyanin through modulation of tyrosinase expression by upregulation of ERK and downregulation of p38 MAPK signaling pathway" docx

Ngày tải lên : 10/08/2014, 10:20
... included: Tyrosinase: F: 5’-GGCCAGCTTTCAGGCAGAG-GT-3’, R: 5’-TGGTGCTTCATGGGCAAAATC-3’; GAPDH: F: 5’-GCACCACCAACTGCT-TAGC-3’, R: 5’TGCTCAGTGTAGCCCAGG-3’ PCR was performed with 30 cycles Each cycle ... melanogenesis The cellular concentration of cAMP was then analyzed to further characterize the effect of Cpc Figure 2C displays the cellular concentrations of cAMP measured hr after Cpc treatment The ... evidenced by the analyses of immunoblotting and confocal immunofluorescence localization Cpc was found to be at nucleus at the early stage (10 and 30 min) of entrance and then accumulated at cytoplasm...
  • 11
  • 287
  • 0
Báo cáo y học: "Early Characterization of Toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll-like receptors, adaptor proteins and inflammatory response" ppt

Báo cáo y học: "Early Characterization of Toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll-like receptors, adaptor proteins and inflammatory response" ppt

Ngày tải lên : 11/08/2014, 08:21
... Sequence 5'-CCCATTCCGCAGTACTCCATT-3' 5'-TTTCCTTGGGCCATTCCA-3' 5'-CAGTTATCACAAGCTCAAAAGTCTCATGGCCA-3' 5'-TGTGAAGAGTGAGTGGTGCAAGT-3' 5'-ATGGCAGCATCATTGTTCTCAT-3' 5'-TGAACTGGACTTCTCCCATTTCCGTCTTTT-3' ... 5'-CCTGGTTTGTTAATTGGATTAACGA-3' 5'-GAGGTGGAGTGTTGCAAAGGTAGT-3' 5'-CCCATACCAACATCCCTGAGCTGTCAA-3' 5'-AGCTCTGCCTTCACTACAGAGACTT-3' 5'-GCTTTTATGGAAACCTTCATGGA-3' 5'-CCCGGTGTGGCCATTGCTGC-3' 5'-GCACTTTTATCAATTGGCTTAATCAC-3' ... 5'-GCACTTTTATCAATTGGCTTAATCAC-3' 5'-AACGAGTCAGGGTACACACAATATATG-3' 5'-CAATGTCACTATAGCTGGGCCTCCTGCAG-3' 5'-CAGTGCTCTTACCCAGATGGA-3' 5'-TCTGATAATCGATGACAGACTTCA-3' 5'-CTGCCTGTGTTTCAATTCACGAAGCT-3' FP:...
  • 15
  • 374
  • 0
Báo cáo y học: " Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia" pot

Báo cáo y học: " Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia" pot

Ngày tải lên : 12/08/2014, 04:20
... Phylogenetic analysis PCR amplification and sequencing were performed using previously described degenerative primers 5′-ATGGGC (C/ T)CCAGA (C/ T)CTTCTAC-3′ (sense) and 5′CTGCCACTGCTAGTTGTGATAATCC-3′ ... min, 56 C for min, and 72 C for min, followed by 72 C for 10 and for HN gene specific primers; 48 at 45 C for RT, 95 C for min, followed by 35 cycles of at 95 C, at 51 C and at 72 C and a final ... 5′CTGCCACTGCTAGTTGTGATAATCC-3′ (antisense) specific to fusion (F) protein gene [13] and HNNDV314 5′-ATATCCCGCAGTCGCATAAC-3′(sense) and HNNDV304 5′-TTTTTCTTAATCAAGTGACT-3′(antisense) specific to HN protein gene [35]...
  • 10
  • 463
  • 0
Báo cáo khoa học: "Correlation of procalcitonin and C-reactive protein to inflammation, complications, and outcome during the intensive care unit course of multiple-trauma patients" pdf

Báo cáo khoa học: "Correlation of procalcitonin and C-reactive protein to inflammation, complications, and outcome during the intensive care unit course of multiple-trauma patients" pdf

Ngày tải lên : 12/08/2014, 23:20
... data collected each day for days, and on days 14 and 21 of treatment in the ICU: PCT, CRP, clinical evi- dence and laboratory data of infection, microbiological findings, clinical suspicion of ... inflammation, the various stages of sepsis according to American College of Chest Physicians/Society of Critical Care Medicine criteria [13], and the occurrence of organ dysfunction The final data analyzed ... fractures according to accepted standards of care PCT, CRP, all clinical, microbiological, and laboratory data, and all diagnostic and therapeutic options were registered The data analyzed included...
  • 10
  • 295
  • 0