... effects Several problems of thermoelasticity and viscoelasticity can also be reduced to this type of problems A variety of problems arising in mechanics, elasticity theory, molecular dynamics, ... equations of second order is proved by studying a full discretization The article is organized as follows In Section 2, we specify some hypotheses, precise sense of the weak solution, then we state ... the question of convergence and existence From Corollary 10, Remark 11 and Kolomogorov compactness criterion, one can cite the following: 14 Corollary 12 There exist subsequences with respect to...
... Applications Substituting 2.22 into 2.21 , we have the following results: u1 x sin ax u2 x λ sin ax π/2a a λ cos ax sin at dt a π/2a cos ax sin ax λ sin ax a λ cos at dt cos ax sin at sin ax u3 x λ cos ... Applications nonlinear system: L u t N u t g t, 1.2 where L is a linear operator, N is a nonlinear operator, and g t is a given continuous function The basic character of the method is to construct ... to converge in the norm of L2 a, b , and to the solution of 1.4 Test Examples In this section we present some test examples to show that the stability of the iteration method is a coefficient condition...
... 1972 Since 1972, a host of authors have studied the weak and strong convergence of iterative processes for such a class of mappings If C is a nonempty closed convex subset of a Hilbert space H ... anonymous referees for their respective helpful discussions and suggestions in preparation of this article This research was supported by grant under the program Strategic Scholarships for Frontier ... convex and smooth Banach space, C a nonempty closed convex subset of E and T : C ® C a closed asymptotically quasi-j-nonexpansive mapping Then, F(T) is a closed convex subset of C Page of 25 Saewan...
... finite elements, Runge-Kutta-based shooting methods or collocation methods In this article, Equation 2.15 are solved using the Chebyshev spectral collocation method The method (see, for example, ... recently, successive linearization method [26-28], has been used successfully to solve nonlinear equations that govern the flow of fluids in bounded domains In this article, boundary layer equations ... interests The authors declare that they have no competing interests Received: 10 November 2010 Accepted: 22 June 2 011 Published: 22 June 2 011 References Blasius, H: Grenzschichten in Flussigkeiten...
... with Lipschitzian condition and without Lipschitzian condition Section deals with some preliminary results of the proposed methods Preliminaries First, let us recall the well-known concepts of monotonicity ... paper, we assume that: A1 the interior set of C, int C is nonempty, A2 the set C is bounded, A3 F is upper semicontinuous on C, and ϕ is proper, closed convex and subdifferentiable on C, A4 F is monotone ... Since F is pseudomonotone, x0 is also a solution to GVI restricted to C ∩ BR x Since x0 ∈ int BR x , for any y ∈ C, we can choose λ > sufficiently small such that yλ : x0 λ y − x ∈ C ∩ BR x ,...
... Let C be a nonempty closed and convex subset of H Let Φ : C × C → R be a bifunction which satisfies the following conditions: A1 Φ x, x for all x ∈ C; A2 Φ is monotone, that is, Φ x, y Φ y, x ≤ for ... Applications, vol 143, no 1, pp 37–58, 2009 S. -S Chang, Y J Cho, and J K Kim, “Approximation methods of solutions for equilibrium problem in Hilbert spaces,” Dynamic Systems and Applications, vol ... semicontinuous functions defined on a nonempty closed and convex subset of C of a Hilbert space H We denote by A the set of solutions of 4.1 and assume that A / ∅ We denote the sets of solutions of the...
... strong convergence by notations and → , respectively Fixed Point Theory and Applications A space H is said to satisfy Opial s condition 29 if for each sequence {xn } in H which converges weakly ... first author was supported by the Faculty of Applied Liberal Arts RMUTR Research Fund and King Mongkut s Diamond scholarship for fostering special academic skills by KMUTT The second author was ... exists a constant ∀x, y ∈ C 1.8 A mapping B is called k-Lipschitz continuous if there exists a positive real number k such that Bx − By ≤ k x − y , ∀x, y ∈ C A mapping B is called β-inverse-strongly...
... Inequalities and Applications Recall that a mapping S : C → C is called nonexpansive if Sx − Sy ≤ x − y for all x, y ∈ C The set of all fixed points of S is denoted by F S , that is, F S {x ∈ C : x Sx} ... which solves some variational inequalities Secondly, by using the first results, we obtain a strong convergence theorem for a common fixed point of nonexpansive mapping and strictly pseudocontractive ... and Applications Lemma 2.4 see Let C be a closed convex subset of a real Hilbert space H and let T : C → C z and be a nonexpansive mapping such that F T / ∅ If a sequence {xn } in C is such that...
... of the phase function for some typical cases in both SAR and ISAR systems (1) For nonmoving targets in SAR systems and for constant velocity targets in ISAR systems, the phase function can be approximated ... (2) So, the received signal is a 2D complex sinusoid (2) Phase function of moving targets in the SAR systems is analyzed in [1] Similar results are observed in some ISAR systems with uniform acceleration ... has a serious drawback in the form of appearance of spurious components called cross-terms The cross-terms may be so emphatic that they mask the useful components Then, design of the TF representations...
... months 10.2 Test Apparatus—Verify test apparatus performance and accuracy at least every 20 tests by testing each reference fluid in accordance with this section Perform one test with each reference ... screws, heater block, and push rod) from contamination by using clean forceps and wearing appropriate gloves 11. 3 Using forceps, place the test disk into the test reservoir, shiny side up Secure ... these cases, it can be more difficult to see or measure the true scar shape; as shown in Fig A1.1, the overall wear scar comprises the distinct and the less distinct areas A1.3 Photographic examples...
... driven cavity is a classic fluid dynamics benchmark that is widely used as standard test cases for evaluating the stability and accuracy of numerical methods for incompressible flow problems Figure ... grid cycling patterns: V-cycle, W-cycle and F-cycle and so on The V-cycle and W-cycle are particularly popular In this project, only V-cycle is considered In the two-grid cycle process, the choice ... system is symmetric hyperbolic-parabolic type and the strict requirement of satisfying mass conservation in each step is relaxed This allows efficient numerical schemes developed for compressible...
... Mathematics, Faculty of Science National University of Singapore Master s thesis Abstract In this thesis, we study a smoothing Newton- BiCGStab methodfor the least squares nonsymmetric matrix nuclear ... smoothing Newton- BiCGStab method is illustrated with the convergence analysis Implementation related issues and numerical experiments will be discussed in Chapter 4, and followed by conclusions in Chapter ... smoothing Newton- BiCGStab method has been shown to resolve such difficulty for the least squares semidefinite programming problems [6] Similarly we may also introduce smoothing functions for the least squares...
... to compute boundary layer correction solutions This method can be easily extended for initial value problems References [1] C Comstock and G C Hsiao, Singular perturbations for difference equations, ... objectives First, we gave sufficient conditions to ensure the existence and uniqueness of the solution of the boundary problem Second, we gave an iterative method to get successive asymptotic approximations ... The comparison with the other formal method requires the analysis of its results We conclude with Section Main result 2.1 Formal asymptotic solution In this section, we develop a perturbation method...
... functions 4.2 Popular approaches forsolving nonlinear Equations System There are several standard known techniques to solve nonlinear equations system Some popular techniques are as follows: Newton- type ... inverse position problem for a six-revolute-joint problem in mechanics The equations describe a denser constraint system and are given as follows: 11S 30 năm 2 011 Tạp chí KHOA H C ĐHSP TPHCM ... problem It is to be noted that solutions found by this approach are Pareto optimal solutions Tạp chí KHOA H C ĐHSP TPHCM S 30 năm 2 011 4.3 PDS algorithm forsolvingEquations System Because there...
... GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ ... Finland) according to the manufacturer s guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG ... electron transmission microscope operated at 120 V All reagents were supplied by Electron Microscopy Sciences (Hatfield, PA, USA) Assessement of SEC-isolated peptides by HPLC and SDS-PAGE Samples (100...
... microscopy (data not shown) tsA58T Ag-negative senescent cells were progressively excluded by serial passages At day 30, the dishes consisted almost exclusively of viable tsA58T Ag-positive cells ... Probes) was used for nuclear staining Fluorescent microscopic photographs were acquired using an Olympus IX70 microscope with DP70 imaging system (Olympus, Tokyo, Japan) For immunocytochemistry, cells ... KM, Tsan RZ, Van Arsdall M, Nilsson MB & Fidler IJ (2003) Tissue-speci c microvascular endothelial cell lines from H–2K(b)–tsA58 mice for studies of angiogenesis and metastasis Cancer Res 63,...
... real Banach spaces with the Fr´chet e differentiable norm 2000 AMS Subject Classification: 47H09; 47H10 Keywords: asymptotically κ-strictly pseudocontractive mappings; demiclosedness principle; the ... It is shown in [5] that the class of asymptotically κ-strictly pseudocontractive mappings and the class of κ-strictly pseudocontractive mappings are independent A mapping T is said to be uniformly ... ≥ (2) The class of asymptotically κ-strictly pseudocontractive mappings was first introduced in Hilbert spaces by Qihou [3] In Hilbert spaces, j is the identity and it is shown by Osilike et al...
... these advances in T -S fuzzy model-based chaos control and synchronization, most works were restricted to chaotic systems without time-delay Due to finite signal transmission times, switching speeds ... dynamics can be increased by increasing the delay time sufficiently 30 For this reason, the time delayed chaotic system has been suggested as a good candidate for secure communication 31 The dimension ... theoretical and practical importance Since Mackey and Glass 11 first found chaos in time delayed system, there has been increasing interest in time delayed chaotic systems 12, 13 The synchronization...