c 1 about the matlab m files

Bài giảng Trắc nghiệm 1 tiết nhóm I,II,Al (ĐA)

Bài giảng Trắc nghiệm 1 tiết nhóm I,II,Al (ĐA)

Ngày tải lên : 01/12/2013, 13:11
... A Ca2+, Mg2+, ClB Ca2+, Mg2+, SO4 2C Cl-, SO42-, HCO3-, Ca2+ D HCO3-, Ca2+, Mg2+ C u 16 Khi điện phân MgCl2 nóng chảy, A c c dương, ion Mg2+ bị oxi hoá B c c m, ion Mg2+ bị khử C c c dương, ... theo chiều tăng điện c c chuẩn D Tính khử kim loại tăng theo chiều tăng độ m điện C u Nư c tự nhiên c chứa ion gọi nư c cứng c tính c ng t m thời? A Ca2+, Mg2+, ClB Ca2+, Mg2+, SO4 2C Cl-, ... SO42-, HCO3-, Ca2+ D HCO3-, Ca2+, Mg2+ C u Khi điện phân MgCl2 nóng chảy, A c c dương, ion Mg2+ bị oxi hoá B c c m, ion Mg2+ bị khử C c c dương, nguyên tử Mg bị oxi hoá D c c m, nguyên tử Mg bị...
  • 4
  • 918
  • 0
Slide đề tài THUYẾT TRÌNH môn ANH văn TALK ABOUT THE STATE OF TRADING SHARES ON VIET NAM STOCK EXCHANGE NOWADAYS  HOW DOES IT INFLUENCE ON THE ECONOMICS OF VIET NAM (1)

Slide đề tài THUYẾT TRÌNH môn ANH văn TALK ABOUT THE STATE OF TRADING SHARES ON VIET NAM STOCK EXCHANGE NOWADAYS HOW DOES IT INFLUENCE ON THE ECONOMICS OF VIET NAM (1)

Ngày tải lên : 07/01/2014, 11:13
... perfect Part 02: How does it influence on the economics of Viet Nam? Positive influence: - To motivate the capital amassment and collection - To forecast the cycle of economics development 1 Positive ... stock market has strong grown, up to 22 /11 /2 010 there are 623 stock code of companies and funds are listed on the stock market in Vietnam 3 The situation of Viet Nam‘s stock market today a Recently, ... Viet Nam stock exchange nowaday? - Part 01 includes 04 subjects: Definition The scale of Viet Nam‘s stock market The situation of Viet Nam‘s stock market today Limitation of Viet Nam‘s stock market...
  • 18
  • 1.2K
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Ngày tải lên : 07/03/2014, 09:20
... OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG ... pmol per 10 9 cells) By subtracting the heme concentration of the omcA– omcB– double mutant from that of MR-1R cells, we calculated a decaheme cytochrome c content (OmcA + OmcB) in MR-1R of about ... MR-1R parent To study the substrate specificities of the outer membrane decaheme cytochromes OmcA and OmcB in the process of dissimilatory metal reduction, omcA–, omcB– and omcA– omcB– MR-1R mutants...
  • 11
  • 731
  • 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

Ngày tải lên : 07/03/2014, 11:20
... Water, My Friend the Chauffeur, The Princess Virginia, etc Copyright, 19 07, by The McClure Company Copyright, 19 06, by McClure, Phillips & Co vi The Car of Destiny LADY MONICA To Doña María del ... 15 25 29 35 41 51 57 65 75 81 85 97 10 7 11 7 12 9 13 9 14 5 14 9 15 7 16 9 18 5 19 9 215 223 235 245 2 51 x The Hand Under the Curtains Behind an Iron Grating On the Road to Cadiz The Seven Men ... THE CAR OF DESTINY BY C N AND A M WILLIAMSON Illustrations by Armand Both iv The Car of Destiny NEW YORK THE McCLURE COMPANY MCMVII OTHER BOOKS BY THE SAME AUTHORS Lady Betty Across the Water,...
  • 424
  • 1.3K
  • 0
C#1 introduction to programming and the c language potx

C#1 introduction to programming and the c language potx

Ngày tải lên : 18/03/2014, 02:20
... the C# language 11 Contents Inheritance 10 0 Points 10 0 Persons 10 2 12 he class Object 10 9 13 Abstract classes 11 3 Abstract points 11 3 Loan 11 5 Interfaces 12 2 Points again 12 2 Money 12 3 Static ... 12 3 Static members 13 2 StringBuilder 13 3 More about arrays 13 7 Multi-dimensional arrays 13 9 17 Types 14 3 18 Enum 15 1 14 15 16 Please click the advert Teach with the Best Learn with the Best Agilent ... bookboon.com C# Introduction to programming and the C# language Contents Contents Foreword 11 Part Introduction to C# 13 Introduction 14 Hello World 14 Basic program architecture 18 Print a book 18 ...
  • 30
  • 538
  • 0
Why I’m excited about the Texas pot

Why I’m excited about the Texas pot

Ngày tải lên : 18/03/2014, 03:20
... communities come online in 18 to 24 months.” Dr Mark G Dotzour, Chief Economist, Real Estate Center at Texas A &M University This is why I m excited about the Texas multi-family real estate market ... is the time to step-up investment in Texas multi-family real estate The Financial Crash of 2008 The financial crash of 2008 brought the United States to the brink of economic collapse The market ... investment models focus on the relationship between housing supply and demand to determine desirability Below are some of the socioeconomic trends that are impacting U.S multi-family housing markets...
  • 7
  • 259
  • 0
Báo cáo khoa học: End-damage-specific proteins facilitate recruitment or stability of X-ray cross-complementing protein 1 at the sites of DNA single-strand break repair docx

Báo cáo khoa học: End-damage-specific proteins facilitate recruitment or stability of X-ray cross-complementing protein 1 at the sites of DNA single-strand break repair docx

Ngày tải lên : 23/03/2014, 11:20
... deficient XRCC1 cross-linking was exclusively due to the immunodepletion of APE1, we complemented depleted cell extracts with purified recombinant human APE1 which stimulated XRCC1 binding ⁄ cross-linking ... buffer containing 25 mm Hepes ⁄ KOH, pH 7.9, 10 0 mm KCl, 12 mm MgCl2, 0 .1 mm FEBS Journal 272 (2005) 5753–5763 ª 2005 FEBS Acknowledgements We thank Dr Keith Caldecott for critical reading of the manuscript ... repair Cell 10 4, 10 7 11 7 Mani RS, Karimi-Busheri F, Fanta M, Caldecott KW, Cass CE & Weinfeld M (2004) Biophysical characterization of human XRCC1 and its binding to damaged and undamaged DNA Biochemistry...
  • 11
  • 299
  • 0
Designation: C 184 – 94e1 - Fineness of Hydraulic Cement by the 150-µm (No. 100) and 75-µm (No. 200) Sieves1 ppt

Designation: C 184 – 94e1 - Fineness of Hydraulic Cement by the 150-µm (No. 100) and 75-µm (No. 200) Sieves1 ppt

Ngày tải lên : 10/07/2014, 23:20
... Report the fineness as the amount passing the number sieve on which the determination was made Calculation 6 .1 Calculate the fineness of the samples as follows: 6 .1. 1 When No Correction is Used: F 10 0 ... @~Rs 10 0!/W# (2) F 10 0 Rc Mechanical Sieving 8 .1 Mechanical sieving devices may be used, but the cement shall not be rejected if it meets the fineness requirement when tested by the hand method ... %) 10 Keywords 10 .1 fineness; hydraulic cement; sieve C 18 4 ANNEX (Mandatory Information) A1 METHOD FOR DETERMINATION OF SIEVE CORRECTION can be read off the plot and the difference between the...
  • 3
  • 1.3K
  • 14
Designation: C 430 – 96 - Fineness of Hydraulic Cement by the 45-µm (No. 325) Sieve1 pps

Designation: C 430 – 96 - Fineness of Hydraulic Cement by the 45-µm (No. 325) Sieve1 pps

Ngày tải lên : 10/07/2014, 23:20
... on the 45- m (No 325) sieve, g, and C sieve correction factor (determined as prescribed in Section 4) which may be either plus or minus Example: Procedure 5 .1 Place a 1. 000 g sample of the cement ... (0. 51- mm) Holes Calculation 7 .1 Calculate the fineness of the cement to the nearest 0 .1 % as follows: proportional to the amount of residue Example of Determination of Sieve Correction Factor: ... Rs Corrected residue, Rc Corrected amount passing, F 5 5 + 31. 2 % 0.088 g 0.088 (10 0 + 31. 2) 11 .5 % 10 0 − 11 .5 % 88.5 % Precision and Bias 8 .1 Normal Fineness Product The multilaboratory precision...
  • 3
  • 436
  • 0
NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 1 docx

NHỊP ĐẬP CỦA TUYỆT ĐỐI (Bài nói về Ishavasya Upanishad) - Nguyên Tác: HEARTBEAT OF THE ABSOLUTE (I OSHO) Phần 1 docx

Ngày tải lên : 22/07/2014, 00:20
... c liên quan tới ch m thể chất, ch m thân thể kh c biệt hai ch m Vậy m chắn c phần tử phân biệt c m gi c ch m vào c ch yêu m n: ch m người giận hoàn toàn kh c với ch m yêu m n Và lần nữa, ch m ... nhiệt, tất s c ép, c ch phơi bầy liệu người ch m vào l m từ yêu hay giận Vậy m kinh nghi m kh c biệt ch m c kh c biệt chất Cho nên chắn ch m không đơn tổng nhiệt, s c ép điện tích chuyển vận ... nghiên c u bắt đầu Chân lí m trở nên biểu c trư c tồn Nó c trư c kh m phá hệt c l m Chân lí không hình thành hay xây dựng qua nghiên c u chúng ta; điều nghiên c u l m đem vào th c kinh nghi m Chân...
  • 21
  • 345
  • 1
Giáo trình đào tạo Visual Basic 6.0 1 M cl c 1 2 Mục lục ppt

Giáo trình đào tạo Visual Basic 6.0 1 M cl c 1 2 Mục lục ppt

Ngày tải lên : 22/07/2014, 22:22
... Example Command Connection Cm Cn Fld flds prm prms Rs cmTitles cnTitles fldName fldsTitles prmTitleName prmsNames rsTitles Field Field Collection Parameter Parameter Collection Recordset Structured ... 11 7 10 .4.2 Tạo Instance biểu m u 11 7 10 .4.3 X c định biểu m u 11 8 10 .4.4 Tạo danh sách c a sổ 11 8 11 C ng c VB6 12 0 11 .1 ADD-INS .12 0 ... nhiều c ch: xử lýu thu c tính phương th c Ví dụ, ta c c ch để di chuyển nút lệnh: a thu c tính cmdMove.Left =10 0 cmdMove.Top =10 0 b phương th c cmdMove.Move 10 0 ,10 0 FPT Software Solution Trang :18 /260...
  • 260
  • 379
  • 0
C Programming for the Absolute Beginner phần 1 ppt

C Programming for the Absolute Beginner phần 1 ppt

Ngày tải lên : 05/08/2014, 09:45
... this case the computer screen, another new line is written Table 1. 2 describes some common escape sequences Chapter • Getting Started with C Programming TABLE 1. 2 11 COMMON ESCAPE SEQUENCES Escape ... information on the gcc program by accessing gcc’s man pages (the online manual pages for UNIX commands) from the UNIX prompt as shown here man gcc To execute your program from the Cygwin UNIX prompt, ... Figure 1. 3; you can see the many components that comprise a small C program preprocessor directive begin logical program block multi-line comment block single line comment block main function standard...
  • 40
  • 326
  • 0
Báo cáo y học: "Association of acid phosphatase locus 1*C allele with the risk of" doc

Báo cáo y học: "Association of acid phosphatase locus 1*C allele with the risk of" doc

Ngày tải lên : 12/08/2014, 17:22
... Research & Therapy 2 011 , 13 :R 116 http://arthritis-research.com/content /13 /4/R 116 the total enzymatic activity and the ratio between isoforms F/S, being the ratio F/S 2 :1 in ACP1*A, 4 :1 in ACP1*B ... splicing model for f and s isozyme generation Biochem Biophys Res Commun 19 93, 19 6:440-446 Dissing J: Immunochemical characterization of human red cell acid phosphatase isozymes Biochem Genet 19 87, ... http://arthritis-research.com/content /13 /4/R 116 Page of polymerase chain reaction (PCR) system, according to the conditions recommended by the manufacturer (Applied Biosystems, Foster City, CA, USA) All samples were genotyped at the...
  • 6
  • 250
  • 0
Pro C# 2008 and the .NET 3.5 Platform, Fourth Edition phần 1 doc

Pro C# 2008 and the .NET 3.5 Platform, Fourth Edition phần 1 doc

Ngày tải lên : 12/08/2014, 23:20
... ret } // end of method Calc::Add w 14 s Source Code The Calc.cs and Calc.vb code files are included under the Chapter subdirectory 8849CH 01. qxd 10 /1/ 07 10 :30 AM Page 15 Simpo PDF Merge and Split ... the C# compiler to check your code for CLS compliance using a single NET attribute: // Tell the C# compiler to check for CLS compliance [assembly: System.CLSCompliant(true)] oa d o rg Chapter 16 ... reading the contained metadata The CLR then lays out the type in memory, compiles the associated CIL into platformspecific instructions, performs any necessary security checks, and then executes the...
  • 140
  • 345
  • 1
Báo cáo y học: " Changes in the accessibility of the HIV-1 Integrase C-terminus in the presence of cellular proteins" doc

Báo cáo y học: " Changes in the accessibility of the HIV-1 Integrase C-terminus in the presence of cellular proteins" doc

Ngày tải lên : 12/08/2014, 23:23
... (AS1: 5’CCAGAATTTGACGCAGAGAAGAAGCATCCTCATCCTGTCTACTTGCC 3’, including the 22 terminal nt of IN in italics and 25 nt of the BAD sequence, underlined) Oligonucleotides corresponding to the complete ... AAAGACAGCATGAGGAAGCGA [20], TGTTTTAAGGGCCCCCCGT [44] Cell culture HEK 293T, HEK 293 and HCT 116 cells were cultured in Dulbecco’s modified eagle media (DMEM) supplemented with 10 % foetal calf serum, ... in the pCMVΔR8.74 A BstBIBAD linker was made by annealing S4 (5’-PO4CGAAGCTTCTTCTCTGCGTCAAATTCTGGATTCTCAAAAAATGGAATGGCGTTCTAACGCTGGTGGTTCTTT-3’, BAD inderlined) and AS5 (5’-PO4GCTTAGAACCACCAGCGTTAGAAC-GCCATTCCATTTTTTGAGAATCCAGAATTTGA-CGCAGAGAAGAAGCAA)...
  • 10
  • 321
  • 0
Báo cáo y học: "Mutation in the loop C-terminal to the cyclophilin A binding site of HIV-1 capsid protein disrupts proper virus assembly and infectivity" ppt

Báo cáo y học: "Mutation in the loop C-terminal to the cyclophilin A binding site of HIV-1 capsid protein disrupts proper virus assembly and infectivity" ppt

Ngày tải lên : 13/08/2014, 09:20
... primer SK-38 5'-ATC CAC CTA TCC CAG TAG GAG AAA T-3' (10 90 11 17) and the reverse primer SK-39 5'TTT GGT CCT TGT CTT ATG TCC AGA ATG C- 3' (11 77 12 04) that amplified a 11 5-bp fragment We also examined ... 373 wild-type HIV -1 particle morphology Click here for file [http://www.biomedcentral.com/content/supplementary /17 424690-4 -19 -S3.doc] 10 11 12 13 14 15 16 17 18 Acknowledgements We would like ... PL: Cryoelectron microscopic examination of human immunodeficiency virus type virions with mutations in the cyclophilin A binding loop J Virol 19 98, 72(5):4403-4407 Yoo S, Myszka DG, Yeh C, McMurray...
  • 8
  • 266
  • 0
head first iphone development a learnersguide to creating objective c applications for the iphone 3 phần 1 docx

head first iphone development a learnersguide to creating objective c applications for the iphone 3 phần 1 docx

Ngày tải lên : 14/08/2014, 20:21
... edit them, and work with the connections between the code and these elements All of these elements come from the Cocoa Touch framework, a custom UI framework for the iPhone and the iPod Touch The ... Mac won’t accomplish anything To approximate rotation and check landscape and portrait views, there are some commands under the Hardware menu The Simulator has limitations Memory, performance, ... you can import pictures, locations, and maps without much coding at all For Bob, payment requires proof ! The way to the camera 4 41 There’s a method for checking 4 51 Prompt the user with action...
  • 55
  • 329
  • 0
sáng kiến kinh nghiệm phương pháp dạy học “bài thể dục phát triển chung lớp 9”

sáng kiến kinh nghiệm phương pháp dạy học “bài thể dục phát triển chung lớp 9”

Ngày tải lên : 08/03/2015, 16:04
... h c theo hớng tích c c hoá hoạt động h c tập h c sinh a X c định kiến th c bài, lựa chọn kiến th c để vận dụng phơng pháp dạy h c, nh m tích c c hoạt động h c sinh Theo muốn tổ ch c cho h c sinh ... tự l c chi m lĩnh chi th c sinh h c em c n phải đạt đ c Tạo nhu c u nhận th c có mong muốn t m hiểu động t c cần thiết cho thân Tự l c tham gia vào hoạt động h c tập giáo viên hớng dẫn C điều ... tình c m đem lại ni m vui hứng thú h c tập cho h c sinh Qua vi c th c thay sách giáo khoa lớp khối THCS b c ngoặt, b c tiến c ng đổi giáo d c n c ta, nh m nâng cao chất lợng giáo d c toàn diện Muốn...
  • 14
  • 689
  • 0