by definition there are c ð 5 2 þ ways to select two elements

combinatorics 2nd ed. - r. merris

combinatorics 2nd ed. - r. merris

Ngày tải lên : 31/03/2014, 15:57
... r!ðn À rÞ! nÀr ¼ ¼ > 1; C n; rÞ ðr þ 1Þ! ðn À r À 1Þ! r þ implying that C n; r þ 1Þ > C n; rÞ 1 .2 & EXERCISES Compute (a) C 7; 4Þ (c) C 12; 4Þ (d) C 101; 2 (b) C 10; 5 (e) C 101; 9 9Þ (f) C 12; ... Choice r C( 0,0) C( 1,0) C( 2, 0) C( 3,0) C( 4,0) C( 5, 0) C( 6,0) C( 7,0) n C( 1,1) C( 2, 1) C( 3,1) C( 4,1) C( 5, 1) C( 6,1) C( 7,1) C( 2, 2) C( 3 ,2) C( 4 ,2) C( 5, 2) C( 6 ,2) C( 7 ,2) C( 3,3) C( 4,3) C( 5, 3) C( 6,3) C( 7,3) C( 4,4) ... C n; r C n À r; k À rÞ 11 (b) C n; k C k; rÞ ¼ C n; k À r C n À k þ r; rÞ Pn nÀr (c) j ¼ C n; j C j; rÞ ¼ C n; r 2 Pn jþk C n; jÞ ¼ C n À 1; k À 1Þ (d) j ¼ k ð 1Þ Â Pn 2 P2n Prove that r ¼ C n;...
  • 571
  • 1.5K
  • 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Ngày tải lên : 23/03/2014, 07:20
... GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTTTCGATCGACTTCTTCCATGCGA ... sequence was confirmed by sequence analysis Transformation of pH90a into S cerevisiae PP30[pHSC 82] (MATa trp1 -28 9, leu2-3,1 12, his3 -20 0, ura 3 52 , ade2-101oc, lys2-801am, hsc 82: :kanMX4, hsp 82: :kanMX4 ... PP30[hHsp90b]slt2D (black bars) transformed with pG1-ERK5, either in growth at 25 C (unstressed), heat shocked from 25 C to 37 C for h, or exposed for h to mM caffeine at 25 C In the absence of ERK5 expression,...
  • 11
  • 427
  • 0
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE

EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE

Ngày tải lên : 04/04/2013, 16:17
... 28 ,2 75, 9 42 110, 458 14,067,788 Thailand 24 0 ,59 8 19,769,7 62 103 ,21 1 8, 958 , 6 52 Morocco 1 45, 22 4 14,6 12, 153 71 ,54 1 7,038, 25 6 Hungary 128 ,0 72 11 ,21 8,189 50 ,8 95 4,776 ,23 9 Source: Statistics of the European Customs ... 7, 720 , 857 1,137,339 4, 92 7, 92 640 29 9 27 7,638,818 29 ,54 2 ,54 6 1,93 5, 45 640 399 68 ,56 2, 309 32 ,54 5 ,59 2 7,98 9 ,54 640 411 23 ,988 ,29 8 6 ,26 8 ,26 6 6,88 8,47 640 419 143,903, 058 17,4 15, 669 1,19 5, 23 640 420 ... 1, 25 9 ,4 82, 144 2, 323 ,24 2 668 ,54 9, 155 Vietnam 2, 088 ,56 9 26 9,839,140 881,080 113,314,301 Rumania 1,034, 455 71,481,7 75 430 ,56 1 30,894,861 India 51 2, 797 52 ,706,8 02 2 85, 669 31,108,964 Indonesia 455 ,6 72 50 ,941,707...
  • 66
  • 538
  • 4
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?

EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?

Ngày tải lên : 27/07/2013, 08:50
... 906 95. 3 94.6 Coffee 50 7 58 2 60 73 56 7 655 87.4 129 .4 Vegetable 1 32 20 1 52 111.4 s Latex 29 0 51 7 55 118 3 45 6 35 141.6 21 3 .2 Pepper 76 109 13 20 89 129 136.9 144.3 Cashew 55 21 9 11 45 66 24 6 121 .7 ... y e y 740 9640 4 920 94 .2 122 .4 34 Graduation thesis Coal Garment, 136 15 428 22 00 70 158 15 498 167 .2 1 35. 4 27 62 600 33 62 1 32. 1 Footwear 1747 340 20 87 122 .3 Bags, 25 1 50 301 108 .5 770 130 900 119.8 ... 1.130 1 ,57 5 1 ,21 2 1,846 1, 421 2, 267 1,7 45 2, 640 2, 0 32 3,039 2, 340 r export National 14,44 11, 124 15, 10 11, 62 16,70 12, 85 20 ,60 15, 86 26 ,50 20 ,40 total export Proporti 10,16 10,43 11, 05 11,00...
  • 84
  • 544
  • 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Ngày tải lên : 21/02/2014, 01:21
... Pur4 AtaP5/ Pur5 AtaP7/ Pur7 AtaP10/ Pur10 26 8 27 3 427 429 22 8 22 8 1 72 1 52 361 338 % Similarity % Identity 76.8 72. 9 80 .5 74.9 73.1 65. 6 70.6 65. 0 61.3 55 .2 sequences were proposed to have phosphatase, ... (pIJ7 02) Dpur10 (pIJ7 02) Dpur10 (pSEXP0 .2) Dpur10 (pA2A10) Dpur4 (pIJ7 02) Dpur4 (pSEXP4 .2) Dpur4 (pA2A4) Dpur5 (pIJ7 02) Dpur5 (pFV8) Dpur5 (pA2A5) 3 .29 1.68 0.03 0.89 0. 95 0. 02 0. 32 0 .22 0.00 0. 35 ... (19 95) The ard1 gene from Streptomyces capreolus encodes a polypeptide of the ABC-transporters superfamily which confers resistance to the aminonucleoside antibiotic A201A Eur J Biochem 22 8, 56 2 56 9...
  • 9
  • 728
  • 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Ngày tải lên : 23/03/2014, 04:20
... mutagenic forward primers were used: Y286A, 5 -GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5 -GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â ... junction turnover J Cell Sci 116, 22 1 322 22 52 Simard M, Arcuino G, Takano T, Liu QS & Nedergaard M (20 03) Signaling at the gliovascular interface J Neurosci 23 , 9 25 4 926 2 53 Haller C, Kiessling F & Kubler ... primers containing ClaI sites (underlined): 5 -GATCATATCGATACAGCAGCGGAG TTT-3Â (forward) and 5 -GATCATATCGATGCCGCT TTACTTGTA-3Â (reverse) PCR products were digested with FEBS Journal 27 6 (20 09) 69 927 005...
  • 14
  • 433
  • 0
Learning a language can transform us as individuals – it can change our worldview and even our personality

Learning a language can transform us as individuals – it can change our worldview and even our personality

Ngày tải lên : 31/05/2014, 13:04
... translation  Co-operating or negotiating with other foreign companies or countries Changing your personality  Feeling more confident to communicate with other people  Being affected various ... with other people  Being affected various lifestyle - Being much better equipped to adapt a fastchanging world -Learning to effectively handle new situations THE END Thank you for your attention ... Learning a language can transform us as individuals – it can change our worldview and even our personality DEFINITION Language Worldview Personality Learning a...
  • 13
  • 675
  • 0
báo cáo khoa học: "A non-healing corneal ulcer as the presenting feature of type 1 diabetes mellitus: a case report" pps

báo cáo khoa học: "A non-healing corneal ulcer as the presenting feature of type 1 diabetes mellitus: a case report" pps

Ngày tải lên : 10/08/2014, 22:20
... analysis Arch Ophthalmol 1989, 107: 1 52 0- 1 52 3 Sakamoto A, Sasaki H, Kitagawa K: Successful treatment of diabetic keratopathy with punctal occlusion Acta Ophthalmol Scand 20 04, 82: 1 15- 117 Klocek MS, ... diabetic keratopathy Br J Ophthalmol 20 05, 89: 25 4 - 25 5 Azar DT, Spurr-Michaud SJ, Tisdale AS, Gipson IK: Decreased penetration of anchoring fibrils into the diabetic stroma A morphometric analysis ... formation [2] A combination of good glycemic control and regular visits to the eye clinic can often slow or halt the progression of the disease Diabetic keratopathy is a rare complication of the condition...
  • 14
  • 305
  • 0
Báo cáo y học: " Trans-inhibition of HIV-1 by a long hairpin RNA expressed within the viral genome" pps

Báo cáo y học: " Trans-inhibition of HIV-1 by a long hairpin RNA expressed within the viral genome" pps

Ngày tải lên : 13/08/2014, 09:20
... 100 20 0 75 75 150 50 50 100 25 25 50 0 HIV HIV-lhNef HIV-CMV HIV-asCMV R1 trans-inhibition of HIV-1 150 150 CA-p24/RL (%) 1 25 1 25 100 100 75 75 150 100 50 50 25 25 50 shNef HIV-lhNef HIV-CMV ... tTA1-AD (+ 826 9 to + 828 9, ACA GCC ATA GCA GTA GCT GAG) and 3' U5 primer CN1 (+ 928 3 to +9 25 3 , GGT CTG AGG GAT CTC TAG TTA CCA GAG TC) (Fig 1) PCR amplification was performed in a 50 μl reaction containing ... approach for inhibition of HIV-1 by RNA interference: counteracting viral escape with a second generation of siRNAs Journal of RNAi and Gene Silencing 20 05, 1 (2) :56 - 65 24 25 26 27 28 29 30 31 32...
  • 14
  • 348
  • 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988  No part of this publication may be reproduced in any material form (including photocopying or stori

The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori

Ngày tải lên : 15/03/2015, 21:24
... thất 24 Đèn c nh báo đèn phanh 25 Đèn c nh báo l c hạt diesel 26 Đèn báo lỗi m c kéo 27 Đèn c nh báo lỗi hệ thống treo 28 Đèn c nh báo chuyển đường 29 Đèn c nh báo lỗi chuyển đổi x c t c 30 Đèn ... 50 Đèn c nh báo l c nhiên liệu 51 Đèn báo c a xe mở 52 Đèn báo nắp capô mở 53 Đèn báo xe hết nhiên liệu 54 Đèn c nh báo lỗi hộp số tự động 55 Đèn báo giới hạn t c độ 56 Đèn báo giảm x c 57 Đèn ... Đèn c nh báo khoảng c ch 17 Đèn báo nhấn chân c n 18 Đèn báo nhấn chân phanh 19 Đèn báo khóa vô-lăng 20 Đèn báo bật đèn pha 21 Đèn báo áp suất lốp m c thấp 22 Đèn báo thông tin đèn xi-nhan 23 ...
  • 3
  • 508
  • 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988  No part of this publication may be reproduced in any material form (including photocopying or stori

The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori

Ngày tải lên : 15/03/2015, 21:25
... In June, In 20 12, In two weeks… On: ngày tháng x c định lịch: April 1st , Christmas, … Unit 2+ 4 Present continuous C ng th c: S + is/am /are + V-ing Usage: Dùng để hành động diễn l c nói Vd: Your ... might – Điều C THỂ làm, C THỂ xảy You may pass this test (c hội khoang 50 % cao hơn) You might pass this test (c hội 50 % trở xuống) II C c câu giao tiếp I’d like to invite you to Thank you ... your girlfriend Be going to: Chỉ hành động c dự tính trư c dự đoán c sở VD: You are going to fail Be + Ving: Chỉ hành động c dự tính chắn, kế hoạch chuẩn bị VD: I’m passing this final test III...
  • 7
  • 425
  • 0
quan hệ nhật bản – đông nam á thời cận đại từ cuối thế kỷ xix đến 1945

quan hệ nhật bản – đông nam á thời cận đại từ cuối thế kỷ xix đến 1945

Ngày tải lên : 02/12/2015, 08:56
... giá cho đ c lập thông qua hiệp ư c bất bình đẳng” [53 , tr 46] C ng với chương trình c i c ch nư c với m c đích biến đổi Xiêm thành nư c đại, c khả chống lại áp l c từ bên Bắt đầu thời vua Chulalongkorn ... Nam chống xâm lư c Pháp, không hiểu t c dụng kháng chiến Việt Nam” [23 , tr . 52 ] Điều lý giải l c ông dồn hết tâm s c vào vi c cổ vũ cho văn minh hóa Nhật Bản, c ch đừng để c ờng qu c phương Tây coi ... Tiên C c chương cuối lời giải thích mở rộng c ng nghiệp Nhật Bản hai chiến tranh phát triển chủ nghĩa dân t c c c đoan – nguyên nhân dẫn đến kiện Mãn Châu, chiến tranh với Trung Qu c cuối Trân Châu...
  • 111
  • 719
  • 1
A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

Ngày tải lên : 29/01/2014, 00:23
... không (thể) đ c, không đ c, ( 45) Chúng ta nói chuyện lại c lợi; làm cho c bị sầu não trái lại c gột rửa đ c cho (1: 28 2) ( The more you and I converse, the better; for while I cannot blight ... subject of the sentence by the speaker (or by some other agents) In the epistemic world, the must in the same sentence could be read as a logical necessity according to the reasoning I must conclude ... they can produce grammatically correct utterances, but not understand properly the social and cultural information each modal meaning conveys Furthermore, due to the structuralist approach to grammar...
  • 56
  • 2.6K
  • 19
Báo cáo khoa học: "GIST suture-line recurrence at a gastrojejunal anastomosis 8 years after gastrectomy: can GIST ever be described as truly benign? A case report" pdf

Báo cáo khoa học: "GIST suture-line recurrence at a gastrojejunal anastomosis 8 years after gastrectomy: can GIST ever be described as truly benign? A case report" pdf

Ngày tải lên : 09/08/2014, 03:22
... tumors: epidemiology, clinical picture, diagnosis, prognosis and treatment Pol Arch Med Wewn 20 08, 118(4) :21 6 -21 , Review Edge SE, Byrd DR, Carducci MA, Compton CC, eds: AJCC Cancer Staging Manual ... in Iceland, 1990 -20 03: the Icelandic GIST study, a population-based incidence and pathologic risk stratification study Int J Cancer 20 05, 117 (2) :28 9-93 Demetri GD, von Mehren M, Antonescu CR, ... Pathol 20 02, 33 (5) : 459 - 65 Miettinen M, Sobin LH, Lasota J: Gastrointestinal stromal tumors of the stomach: a clinicopathologic,immunohistochemical, and molecular genetic study of 17 65 cases with...
  • 4
  • 284
  • 0
Báo cáo y học: "Frozen Elephant Trunk: A technique which can be offered in complex pathology to fix the whole aorta in one setting" pps

Báo cáo y học: "Frozen Elephant Trunk: A technique which can be offered in complex pathology to fix the whole aorta in one setting" pps

Ngày tải lên : 10/08/2014, 09:21
... side branch of the arch graft CPB was commenced and flow was maintained between 2. 2 -2. 4 L per per square meter of body surface area A retrograde cardioplegia catheter was placed in the coronary ... was placed across the ascending aorta and resected above the coronary ostia in the sinotubular junction Myocardial arrest was achieved with cold crystalloid cardioplegia 25 ml kg-1 (Custodiol, ... entire thoracic aorta and concomitant cardiac pathology Kokotsakis et al Journal of Cardiothoracic Surgery 20 11, 6:66 http://www.cardiothoracicsurgery.org/content/6/1/66 Figure Postoperative...
  • 5
  • 571
  • 0
Báo cáo y học: "Retention of foreign body in the gut can be a sign of congenital obstructive anomaly: a case report" potx

Báo cáo y học: "Retention of foreign body in the gut can be a sign of congenital obstructive anomaly: a case report" potx

Ngày tải lên : 11/08/2014, 21:22
... Medical Case Reports 20 08, 2: 293 http://www.jmedicalcasereports.com/content /2/ 1 /29 3 been advised [4 ,5] In addition, objects longer than cm frequently fail to negotiate the C- curve and become ... Laparoscopic retrieval of 'stubborn' foreign bodies in the foregut: a case report and literature survey Surg Laparosc Endosc Percutan Tech 20 07, 17 : 52 8 -53 1 Conclusion The present case is reported to ... DA: Crohn's disease discovered by an obstructing chick pea Br J Hosp Med (Lond) 20 07, 68:4 45 Lerma MA, Mariscal JME, Cordon FD, Abril AG, Oron EM, Perez MJM: Small bowel obstruction caused by...
  • 3
  • 387
  • 0
Báo cáo y học: " Polyclonal antibody against the DPV UL46M protein can be a diagnostic candidate" pot

Báo cáo y học: " Polyclonal antibody against the DPV UL46M protein can be a diagnostic candidate" pot

Ngày tải lên : 12/08/2014, 04:20
... 5' GGATCCCCGCTGGATCTTATGGTT-3' and reverse primer (P2) 5' -CTCGAGTTATTTCCCAAATGACAGTCT-3' [20 ] The BamHI and XhoI sites that were used to clone the PCR fragment are bolded in the primer sequences ... ultrapure water to a total reaction volume of 25 μL The PCR cycle parameters were as follows: (A) the complete UL46 gene: at 95 C and 30 cycles of at 94 C, at 59 C, 40 s at 72 C, and a final extension ... Analytical Biochemistry 1976, 72: 248- 25 4 23 Hu YX, Guo JY, Shen L, Chen Y, Zhang ZC, Zhang YL: Get effective polyclonal antisera in one month Cell res 20 02, 12: 157 -160 24 Walker JM: Purification...
  • 10
  • 271
  • 0
Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Ngày tải lên : 12/08/2014, 16:20
... 5. 0 2 .5 2 .5 0.0 0 .5 1.0 47 .5 50.0 52 .5 55. 0 57 .5 60.0 BWT (%) - all lobes 1 .5 BWT score for right lower lobe 3b 4b 10.0 RBM(µ m) RBM (µ m) 7 .5 5.0 2 .5 0.0 10.0 7 .5 5.0 2 .5 45 0 .5 1.0 BWT score right ... accordance with American Thoracic Society guidelines Table 1: Clinical characteristics of children with difficult asthma Number 27 Age* Male/Female FEV1 (% predicted)*, pre-bronchodilator a Atopic ... symptomatic infants with reversible airflow obstruction Am J Respir Crit Care Med 20 05, 171: 722 - 727 Standardization of Spirometry, 1994 Update American Thoracic Society Am J Respir Crit Care...
  • 9
  • 390
  • 0
Báo cáo y học: " Initial distribution volume of glucose can be approximated using a conventional glucose analyzer in the intensive care unit" pot

Báo cáo y học: " Initial distribution volume of glucose can be approximated using a conventional glucose analyzer in the intensive care unit" pot

Ngày tải lên : 12/08/2014, 20:21
... 8.0 81 4.8 111 3.6 52 7.8 82 4.8 1 12 3 .5 53 7.7 83 4.7 113 3 .5 54 7 .5 84 4.7 114 3 .5 55 7.4 85 4.6 1 15 3 .5 56 7 .2 86 4 .5 116 3 .5 57 7.1 87 4 .5 117 3.4 58 7.0 88 4.4 118 3.4 59 6.9 89 4.4 119 3.4 ... glucose reflectance meters in an intensive care unit: are they accurate? Crit Care Med 1994, 22 :59 5 -59 9 Karcher RE, Ingram RL, Kiechle FL, Sykes E: Comparison of the HomoCue berta-glucose photometer ... AC-19:716- 723 Ray JG, Hamielec C, Mastracci T: Pilot study of the accuracy of bedside glucometry in the intensive care unit Crit Care Med 20 01, 29 :22 05- 22 07 Maser RE, Butler MA, Decherney GS: Use of arterial...
  • 6
  • 286
  • 0